Incidental Mutation 'R4464:Stat1'
ID330256
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 52137416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 257 (D257E)
Ref Sequence ENSEMBL: ENSMUSP00000139746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000188681] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070968
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185743
Predicted Effect possibly damaging
Transcript: ENSMUST00000186057
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186574
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186857
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188681
SMART Domains Protein: ENSMUSP00000141144
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189347
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191435
AA Change: D257E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: D257E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Meta Mutation Damage Score 0.2905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7284:Stat1 UTSW 1 52148922 missense probably benign 0.01
R7309:Stat1 UTSW 1 52126621 splice site probably null
R7491:Stat1 UTSW 1 52152371 missense probably benign 0.31
R7680:Stat1 UTSW 1 52144209 missense probably damaging 1.00
R7825:Stat1 UTSW 1 52151308 missense probably damaging 0.98
RF036:Stat1 UTSW 1 52152260 missense probably benign
RF060:Stat1 UTSW 1 52152260 missense probably benign
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCAGCAAAATAGGAAGAGAT -3'
(R):5'- GGTTTTGTGTGGTCAAAATCAGG -3'

Sequencing Primer
(F):5'- ACAAACAAACAACCCTCTCG -3'
(R):5'- AGGCAATCAAGCAGACGTAG -3'
Posted On2015-07-21