Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Armc3'

330259

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

041722-MU

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19248659 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 204 (Y204H)

Ref Sequence

ENSEMBL: ENSMUSP00000048784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049255
AA Change: Y204H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: Y204H

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114640
AA Change: Y204H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: Y204H

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Meta Mutation Damage Score

0.1825

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5739:Armc3	UTSW	2	19253917	missense	possibly damaging	0.67
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7927:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R8060:Armc3	UTSW	2	19288909	missense	not run
Z1177:Armc3	UTSW	2	19285991	missense	not run

Predicted Primers

PCR Primer
(F):5'- TCCATGAAGAGTTTTCTTTTGTCCG -3'
(R):5'- GACTTGCTCCTGTAAACTCTGC -3'

Sequencing Primer
(F):5'- CGTGAGTTATTTTGGAATCTGGAAAC -3'
(R):5'- GCTCCTGTAAACTCTGCTTATTAG -3'

Posted On

2015-07-21