Incidental Mutation 'R4464:Armc3'
ID330259
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Namearmadillo repeat containing 3
Synonyms4921513G22Rik
MMRRC Submission 041722-MU
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location19199302-19310241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19248659 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 204 (Y204H)
Ref Sequence ENSEMBL: ENSMUSP00000048784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
Predicted Effect probably damaging
Transcript: ENSMUST00000049255
AA Change: Y204H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: Y204H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114640
AA Change: Y204H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: Y204H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Meta Mutation Damage Score 0.1825 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7003:Armc3 UTSW 2 19270028 missense probably damaging 1.00
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7927:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R8060:Armc3 UTSW 2 19288909 missense not run
Z1177:Armc3 UTSW 2 19285991 missense not run
Predicted Primers PCR Primer
(F):5'- TCCATGAAGAGTTTTCTTTTGTCCG -3'
(R):5'- GACTTGCTCCTGTAAACTCTGC -3'

Sequencing Primer
(F):5'- CGTGAGTTATTTTGGAATCTGGAAAC -3'
(R):5'- GCTCCTGTAAACTCTGCTTATTAG -3'
Posted On2015-07-21