Incidental Mutation 'R4464:Dennd1a'
ID 330261
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene Name DENN/MADD domain containing 1A
Synonyms 6030446I19Rik
MMRRC Submission 041722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R4464 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 37798991-38287390 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 38243390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000130472] [ENSMUST00000140552] [ENSMUST00000142813] [ENSMUST00000143095] [ENSMUST00000150896]
AlphaFold Q8K382
Predicted Effect probably benign
Transcript: ENSMUST00000102787
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128492
Predicted Effect probably benign
Transcript: ENSMUST00000130472
SMART Domains Protein: ENSMUSP00000119892
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 64 4e-20 BLAST
PDB:3TW8|C 44 105 3e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136116
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Predicted Effect probably benign
Transcript: ENSMUST00000142813
SMART Domains Protein: ENSMUSP00000116396
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
Blast:uDENN 9 29 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143095
Predicted Effect probably benign
Transcript: ENSMUST00000150896
SMART Domains Protein: ENSMUSP00000116723
Gene: ENSMUSG00000035392

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R0784:Dennd1a UTSW 2 38021414 missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37852441 missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
R7408:Dennd1a UTSW 2 37852172 splice site probably null
R7446:Dennd1a UTSW 2 37816979 missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37858432 missense probably damaging 0.99
R7645:Dennd1a UTSW 2 38021363 missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37844829 missense probably benign
R8132:Dennd1a UTSW 2 37858060 missense probably damaging 1.00
R8305:Dennd1a UTSW 2 37858081 missense probably damaging 1.00
R8369:Dennd1a UTSW 2 38048754 missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37858391 missense probably benign 0.36
R8438:Dennd1a UTSW 2 37856138 missense probably benign 0.08
R8544:Dennd1a UTSW 2 37982908 splice site probably null
R8997:Dennd1a UTSW 2 37800485 missense probably benign 0.14
R9052:Dennd1a UTSW 2 38021451 missense probably damaging 1.00
R9087:Dennd1a UTSW 2 38021354 critical splice donor site probably null
R9096:Dennd1a UTSW 2 37800065 missense probably damaging 1.00
R9346:Dennd1a UTSW 2 38021435 missense probably benign 0.12
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Z1177:Dennd1a UTSW 2 37800257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAAAGCAGTGGATCCCAAAG -3'
(R):5'- GACACAGGTTAAGTCATAGTCATGG -3'

Sequencing Primer
(F):5'- GCAGTGGATCCCAAAGTATTCACTG -3'
(R):5'- GTTGTGGCCCAGAAGTTAAATACCC -3'
Posted On 2015-07-21