Incidental Mutation 'R4464:Cst12'
ID330263
Institutional Source Beutler Lab
Gene Symbol Cst12
Ensembl Gene ENSMUSG00000027443
Gene Namecystatin 12
Synonymscystatin TE-1, 1700006F03Rik
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148789361-148793546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148789517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 53 (V53I)
Ref Sequence ENSEMBL: ENSMUSP00000126008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028932] [ENSMUST00000028933] [ENSMUST00000168443]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028932
AA Change: V40I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028932
Gene: ENSMUSG00000027443
AA Change: V40I

DomainStartEndE-ValueType
CY 18 126 9.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028933
SMART Domains Protein: ENSMUSP00000028933
Gene: ENSMUSG00000027444

DomainStartEndE-ValueType
CY 20 128 2.25e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168443
AA Change: V53I

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126008
Gene: ENSMUSG00000027443
AA Change: V53I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 31 139 4.8e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Cst12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Cst12 APN 2 148789548 missense probably damaging 1.00
IGL02069:Cst12 APN 2 148792448 missense probably damaging 1.00
R1517:Cst12 UTSW 2 148793252 missense possibly damaging 0.49
R4764:Cst12 UTSW 2 148789473 missense possibly damaging 0.78
R7862:Cst12 UTSW 2 148789575 missense probably damaging 0.97
R8199:Cst12 UTSW 2 148789539 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ATGTGGGATGCATCACCATCTG -3'
(R):5'- AGACATTGGTGCCTCCCTTC -3'

Sequencing Primer
(F):5'- GCATCACCATCTGCAGCTG -3'
(R):5'- CCTTTCAGAGGCTACACTCAC -3'
Posted On2015-07-21