Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Lrrcc1'

330264

Institutional Source

Beutler Lab

Gene Symbol

Lrrcc1

Ensembl Gene

ENSMUSG00000027550

Gene Name

leucine rich repeat and coiled-coil domain containing 1

Synonyms

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14533788-14572658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14557318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 694 (K694E)

Ref Sequence

ENSEMBL: ENSMUSP00000126560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000167858] [ENSMUST00000169079]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091325
AA Change: K678E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: K678E

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	126	4.8e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
coiled coil region	412	626	N/A	INTRINSIC
coiled coil region	675	718	N/A	INTRINSIC
coiled coil region	757	1010	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108370
AA Change: K694E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: K694E

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	124	4.5e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	953	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163660
AA Change: K572E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: K572E

Domain	Start	End	E-Value	Type
Blast:LRR	8	29	7e-6	BLAST
SCOP:d1dcea3	9	71	9e-4	SMART
low complexity region	167	179	N/A	INTRINSIC
coiled coil region	306	520	N/A	INTRINSIC
coiled coil region	569	612	N/A	INTRINSIC
coiled coil region	651	716	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167858
AA Change: K273E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550
AA Change: K273E

Domain	Start	End	E-Value	Type
coiled coil region	7	221	N/A	INTRINSIC
coiled coil region	270	313	N/A	INTRINSIC
low complexity region	450	472	N/A	INTRINSIC
SCOP:d1ek8a_	494	550	7e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169079
AA Change: K694E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: K694E

Domain	Start	End	E-Value	Type
Pfam:LRR_4	60	102	4.3e-9	PFAM
internal_repeat_1	109	145	1.05e-6	PROSPERO
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	1026	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169799

SMART Domains

Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	1	131	N/A	INTRINSIC
coiled coil region	200	228	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171620

SMART Domains

Protein: ENSMUSP00000128252
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	30	91	N/A	INTRINSIC

Meta Mutation Damage Score

0.1418

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Lrrcc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Lrrcc1	APN	3	14536128	missense	possibly damaging	0.91
IGL01325:Lrrcc1	APN	3	14536541	critical splice donor site	probably null
IGL01681:Lrrcc1	APN	3	14548226	missense	probably benign	0.35
IGL01767:Lrrcc1	APN	3	14547272	missense	probably damaging	0.97
IGL01868:Lrrcc1	APN	3	14554357	nonsense	probably null
IGL03123:Lrrcc1	APN	3	14536084	missense	probably damaging	0.97
PIT1430001:Lrrcc1	UTSW	3	14545596	missense	probably damaging	0.99
R0295:Lrrcc1	UTSW	3	14565849	missense	probably benign	0.05
R0427:Lrrcc1	UTSW	3	14558356	missense	probably damaging	1.00
R0433:Lrrcc1	UTSW	3	14559374	missense	probably damaging	1.00
R0534:Lrrcc1	UTSW	3	14557273	missense	probably damaging	1.00
R0631:Lrrcc1	UTSW	3	14540119	splice site	probably benign
R0635:Lrrcc1	UTSW	3	14559228	missense	probably benign	0.11
R1355:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1370:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1727:Lrrcc1	UTSW	3	14537363	missense	probably damaging	0.99
R1822:Lrrcc1	UTSW	3	14559225	unclassified	probably benign
R1946:Lrrcc1	UTSW	3	14550393	missense	probably benign	0.02
R2254:Lrrcc1	UTSW	3	14547255	missense	probably damaging	1.00
R2362:Lrrcc1	UTSW	3	14563024	missense	probably damaging	1.00
R2392:Lrrcc1	UTSW	3	14536520	missense	probably damaging	1.00
R4105:Lrrcc1	UTSW	3	14550328	missense	probably benign	0.21
R4484:Lrrcc1	UTSW	3	14551443	missense	probably damaging	1.00
R4543:Lrrcc1	UTSW	3	14539791	missense	probably damaging	0.98
R4718:Lrrcc1	UTSW	3	14536032	missense	probably damaging	1.00
R4734:Lrrcc1	UTSW	3	14562285	missense	probably damaging	1.00
R4799:Lrrcc1	UTSW	3	14536096	nonsense	probably null
R4841:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R4842:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R5900:Lrrcc1	UTSW	3	14562126	missense	possibly damaging	0.69
R6338:Lrrcc1	UTSW	3	14547316	missense	possibly damaging	0.48
R7001:Lrrcc1	UTSW	3	14540095	missense	probably damaging	0.99
R7036:Lrrcc1	UTSW	3	14563009	missense	possibly damaging	0.80
R7342:Lrrcc1	UTSW	3	14554371	missense	probably benign
R8038:Lrrcc1	UTSW	3	14565830	missense	possibly damaging	0.77
R8497:Lrrcc1	UTSW	3	14539984	missense	possibly damaging	0.80
R8509:Lrrcc1	UTSW	3	14536507	missense	probably damaging	1.00
R8679:Lrrcc1	UTSW	3	14536024	missense	probably benign	0.00
R8966:Lrrcc1	UTSW	3	14537299	missense	probably damaging	1.00
R9120:Lrrcc1	UTSW	3	14550429	nonsense	probably null
R9251:Lrrcc1	UTSW	3	14558394	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCAAATGAGTAGCAAACCC -3'
(R):5'- AGGATCACTTTCCAGCCTCTG -3'

Sequencing Primer
(F):5'- TGAGTAGCAAACCCCCTAGG -3'
(R):5'- ACAGGGTCTCACTGTGTAGAC -3'

Posted On

2015-07-21