Incidental Mutation 'R4464:Slc34a2'
ID 330266
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission 041722-MU
Accession Numbers

Genbank: NM_011402; MGI: 1342284
Essential gene? Essential (E-score: 1.000) question?
Stock # R4464 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53069182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 490 (L490P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect probably damaging
Transcript: ENSMUST00000094787
AA Change: L549P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: L549P

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Predicted Effect probably damaging
Transcript: ENSMUST00000168667
AA Change: L490P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132328
Gene: ENSMUSG00000029188
AA Change: L490P

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 253 1.2e-33 PFAM
Pfam:Na_Pi_cotrans 379 517 4.1e-15 PFAM
low complexity region 557 586 N/A INTRINSIC
low complexity region 590 596 N/A INTRINSIC
Meta Mutation Damage Score 0.2834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5313:Slc34a2 UTSW 5 53069339 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGACCTGGAGTGACTCTTAC -3'
(R):5'- TGTCCCAGGGTTTCAGAGAG -3'

Sequencing Primer
(F):5'- AGACCTGGAGTGACTCTTACTTCTTC -3'
(R):5'- GGTTTCAGAGAGTGCATCCAC -3'
Posted On 2015-07-21