Mutagenetix > Incidental Mutation

Incidental Mutation 'R4464:Mbd4'

330269

Institutional Source

Beutler Lab

Gene Symbol

Mbd4

Ensembl Gene

ENSMUSG00000030322

Gene Name

methyl-CpG binding domain protein 4

Synonyms

Med1

MMRRC Submission

041722-MU

Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115840697-115853371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115849502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 155 (L155S)

Ref Sequence

ENSEMBL: ENSMUSP00000125619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000122816] [ENSMUST00000141305] [ENSMUST00000147282] [ENSMUST00000203643]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000032469
AA Change: L176S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322
AA Change: L176S

Domain	Start	End	E-Value	Type
MBD	66	142	1.25e-29	SMART
low complexity region	178	196	N/A	INTRINSIC
PDB:1NGN\|A	400	554	1e-111	PDB
SCOP:d1keaa_	405	545	1e-23	SMART
Blast:ENDO3c	439	514	2e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000038234

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112923

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112925

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122816
AA Change: L176S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322
AA Change: L176S

Domain	Start	End	E-Value	Type
MBD	66	142	7.6e-32	SMART
low complexity region	178	196	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125889

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133830

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000147282
AA Change: L155S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322
AA Change: L155S

Domain	Start	End	E-Value	Type
MBD	45	121	1.25e-29	SMART
low complexity region	157	175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203243

Predicted Effect

probably benign
Transcript: ENSMUST00000203643

SMART Domains

Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322

Domain	Start	End	E-Value	Type
Pfam:HhH-GPD	56	168	2.7e-5	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Mbd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01516:Mbd4	APN	6	115849530	missense	probably damaging	0.99
IGL01545:Mbd4	APN	6	115850797	missense	probably damaging	1.00
IGL01657:Mbd4	APN	6	115849637	missense	probably damaging	0.99
IGL02406:Mbd4	APN	6	115849025	missense	possibly damaging	0.96
E0370:Mbd4	UTSW	6	115849155	missense	possibly damaging	0.91
R0025:Mbd4	UTSW	6	115844568	critical splice donor site	probably null
R0025:Mbd4	UTSW	6	115844568	critical splice donor site	probably null
R0538:Mbd4	UTSW	6	115849482	missense	probably damaging	0.99
R2085:Mbd4	UTSW	6	115848957	missense	probably benign	0.01
R4405:Mbd4	UTSW	6	115849115	missense	possibly damaging	0.92
R4780:Mbd4	UTSW	6	115849384	missense	probably benign
R4782:Mbd4	UTSW	6	115845322	missense	possibly damaging	0.49
R4799:Mbd4	UTSW	6	115845322	missense	probably benign	0.26
R4814:Mbd4	UTSW	6	115849299	missense	possibly damaging	0.85
R4860:Mbd4	UTSW	6	115848926	missense	possibly damaging	0.51
R4860:Mbd4	UTSW	6	115848926	missense	possibly damaging	0.51
R4976:Mbd4	UTSW	6	115850724	missense	possibly damaging	0.95
R5126:Mbd4	UTSW	6	115848968	splice site	probably null
R5202:Mbd4	UTSW	6	115849402	missense	probably damaging	0.96
R5485:Mbd4	UTSW	6	115850718	missense	probably benign	0.21
R6179:Mbd4	UTSW	6	115845425	missense	probably benign	0.00
R6661:Mbd4	UTSW	6	115849155	nonsense	probably null
R7008:Mbd4	UTSW	6	115850724	missense	possibly damaging	0.95
R7244:Mbd4	UTSW	6	115844603	missense	probably benign	0.00
R7723:Mbd4	UTSW	6	115845363	missense	possibly damaging	0.47
R7755:Mbd4	UTSW	6	115844585	missense	probably damaging	0.99
R7837:Mbd4	UTSW	6	115849539	missense	probably benign	0.20
R8032:Mbd4	UTSW	6	115844633	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTAAGAGACTCTTCCTGCAC -3'
(R):5'- TCAGATCAAAACGTTCACTTGC -3'

Sequencing Primer
(F):5'- AAGAGACTCTTCCTGCACTTTTG -3'
(R):5'- CTTCTCAAAAATGGGGAGACTTTTC -3'

Posted On

2015-07-21