Incidental Mutation 'R4464:Psg29'
ID330271
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17210650 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 362 (N362Y)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075934
AA Change: N362Y

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: N362Y

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
R7297:Psg29 UTSW 7 17210691 nonsense probably null
R7448:Psg29 UTSW 7 17211723 missense possibly damaging 0.90
R8027:Psg29 UTSW 7 17208640 missense not run
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAATGTATAGGGTCCCTGCC -3'
(R):5'- CACACATTCTTCTCTGTGGAGG -3'

Sequencing Primer
(F):5'- AGGGTCCCTGCCTTTAAAATTG -3'
(R):5'- GACTGCTGCTTGTCTACGAAGTAC -3'
Posted On2015-07-21