Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Trim66'

330272

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109477690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 347 (S347R)

Ref Sequence

ENSEMBL: ENSMUSP00000102352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

AlphaFold

Q924W6

Predicted Effect

probably benign
Transcript: ENSMUST00000033339
AA Change: S245R

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: S245R

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106739
AA Change: S245R

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: S245R

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106741
AA Change: S347R

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: S347R

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137704

Meta Mutation Damage Score

0.0801

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
R8855:Trim66	UTSW	7	109481981	missense	probably damaging	1.00
R9130:Trim66	UTSW	7	109477689	missense	possibly damaging	0.90
R9137:Trim66	UTSW	7	109475123	missense	probably damaging	0.99
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGACTGGCTCCATGATCAATG -3'
(R):5'- AACACTGTCTGGGAAGACTG -3'

Sequencing Primer
(F):5'- CAATGGCAGTCTGAGAGCACTTTC -3'
(R):5'- TCCTGGGGACATGGAACTG -3'

Posted On

2015-07-21