Mutagenetix > Incidental Mutation

Incidental Mutation 'R4464:Ifngr1'

330275

Institutional Source

Beutler Lab

Gene Symbol

Ifngr1

Ensembl Gene

ENSMUSG00000020009

Gene Name

interferon gamma receptor 1

Synonyms

CD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19591949-19610229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19597517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 72 (V72I)

Ref Sequence

ENSEMBL: ENSMUSP00000020188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]

AlphaFold

P15261

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020188
AA Change: V72I

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009
AA Change: V72I

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	119	2.2e-27	PFAM
Pfam:Interfer-bind	131	245	8.5e-9	PFAM
Pfam:IFNGR1	168	331	1.6e-53	PFAM
low complexity region	401	416	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110989

Predicted Effect

probably benign
Transcript: ENSMUST00000164591

SMART Domains

Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	74	2.3e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171772

SMART Domains

Protein: ENSMUSP00000127219
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	94	1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172253

SMART Domains

Protein: ENSMUSP00000127484
Gene: ENSMUSG00000020009

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
transmembrane domain	42	64	N/A	INTRINSIC

Meta Mutation Damage Score

0.4323

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Ifngr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ifngr1	APN	10	19609198	missense	probably damaging	0.99
IGL01125:Ifngr1	APN	10	19597413	splice site	probably benign
IGL01366:Ifngr1	APN	10	19609600	missense	probably damaging	1.00
IGL01951:Ifngr1	APN	10	19609454	missense	possibly damaging	0.94
IGL02037:Ifngr1	APN	10	19607259	missense	probably benign	0.26
Marigold	UTSW	10	19601485	critical splice donor site	probably null
BB007:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
BB017:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
R0023:Ifngr1	UTSW	10	19609449	nonsense	probably null
R0325:Ifngr1	UTSW	10	19597432	missense	probably damaging	1.00
R0590:Ifngr1	UTSW	10	19603942	splice site	probably benign
R1305:Ifngr1	UTSW	10	19606253	missense	possibly damaging	0.91
R1496:Ifngr1	UTSW	10	19601445	missense	probably benign	0.04
R1597:Ifngr1	UTSW	10	19609342	missense	probably damaging	0.99
R2019:Ifngr1	UTSW	10	19592113	missense	probably damaging	0.99
R2302:Ifngr1	UTSW	10	19609645	missense	probably damaging	1.00
R2484:Ifngr1	UTSW	10	19601415	missense	probably damaging	1.00
R4089:Ifngr1	UTSW	10	19601485	critical splice donor site	probably null
R4863:Ifngr1	UTSW	10	19609416	missense	probably damaging	1.00
R6045:Ifngr1	UTSW	10	19609161	missense	possibly damaging	0.61
R6047:Ifngr1	UTSW	10	19606313	missense	probably damaging	1.00
R6089:Ifngr1	UTSW	10	19606300	missense	probably benign	0.01
R6750:Ifngr1	UTSW	10	19609351	missense	probably benign	0.06
R6950:Ifngr1	UTSW	10	19607293	missense	probably damaging	0.99
R7162:Ifngr1	UTSW	10	19609353	missense	probably benign
R7930:Ifngr1	UTSW	10	19609183	missense	probably damaging	1.00
R8178:Ifngr1	UTSW	10	19609493	missense	probably benign	0.03
R8436:Ifngr1	UTSW	10	19603805	missense	probably damaging	1.00
R8975:Ifngr1	UTSW	10	19609612	missense	probably damaging	1.00
R9451:Ifngr1	UTSW	10	19607293	missense	possibly damaging	0.61
T0975:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98
X0005:Ifngr1	UTSW	10	19609473	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCGCATGTCTGTCTTTCTAACG -3'
(R):5'- AAACCTTGGAAGTTAGTCGTGTTTC -3'

Sequencing Primer
(F):5'- AACGTCATCTGATCAGGTTTTCTG -3'
(R):5'- GAAGTTAGTCGTGTTTCTCCAC -3'

Posted On

2015-07-21