Incidental Mutation 'R4464:Ifngr1'
ID330275
Institutional Source Beutler Lab
Gene Symbol Ifngr1
Ensembl Gene ENSMUSG00000020009
Gene Nameinterferon gamma receptor 1
SynonymsCD119, Ifgr, IFN-gamma R, Nktar, Ifngr, IFN-gammaR
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19591949-19610229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19597517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 72 (V72I)
Ref Sequence ENSEMBL: ENSMUSP00000020188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020188] [ENSMUST00000164591]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020188
AA Change: V72I

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020188
Gene: ENSMUSG00000020009
AA Change: V72I

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 119 2.2e-27 PFAM
Pfam:Interfer-bind 131 245 8.5e-9 PFAM
Pfam:IFNGR1 168 331 1.6e-53 PFAM
low complexity region 401 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110989
Predicted Effect probably benign
Transcript: ENSMUST00000164591
SMART Domains Protein: ENSMUSP00000129309
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 74 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171772
SMART Domains Protein: ENSMUSP00000127219
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 94 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172253
SMART Domains Protein: ENSMUSP00000127484
Gene: ENSMUSG00000020009

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Meta Mutation Damage Score 0.4323 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutant allele exhibit increased susceptibility to viral infection and experimental autoimmune uveoretinitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Ifngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ifngr1 APN 10 19609198 missense probably damaging 0.99
IGL01125:Ifngr1 APN 10 19597413 splice site probably benign
IGL01366:Ifngr1 APN 10 19609600 missense probably damaging 1.00
IGL01951:Ifngr1 APN 10 19609454 missense possibly damaging 0.94
IGL02037:Ifngr1 APN 10 19607259 missense probably benign 0.26
Marigold UTSW 10 19601485 critical splice donor site probably null
BB007:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
BB017:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R0023:Ifngr1 UTSW 10 19609449 nonsense probably null
R0325:Ifngr1 UTSW 10 19597432 missense probably damaging 1.00
R0590:Ifngr1 UTSW 10 19603942 splice site probably benign
R1305:Ifngr1 UTSW 10 19606253 missense possibly damaging 0.91
R1496:Ifngr1 UTSW 10 19601445 missense probably benign 0.04
R1597:Ifngr1 UTSW 10 19609342 missense probably damaging 0.99
R2019:Ifngr1 UTSW 10 19592113 missense probably damaging 0.99
R2302:Ifngr1 UTSW 10 19609645 missense probably damaging 1.00
R2484:Ifngr1 UTSW 10 19601415 missense probably damaging 1.00
R4089:Ifngr1 UTSW 10 19601485 critical splice donor site probably null
R4863:Ifngr1 UTSW 10 19609416 missense probably damaging 1.00
R6045:Ifngr1 UTSW 10 19609161 missense possibly damaging 0.61
R6047:Ifngr1 UTSW 10 19606313 missense probably damaging 1.00
R6089:Ifngr1 UTSW 10 19606300 missense probably benign 0.01
R6750:Ifngr1 UTSW 10 19609351 missense probably benign 0.06
R6950:Ifngr1 UTSW 10 19607293 missense probably damaging 0.99
R7162:Ifngr1 UTSW 10 19609353 missense probably benign
R7930:Ifngr1 UTSW 10 19609183 missense probably damaging 1.00
R8178:Ifngr1 UTSW 10 19609493 missense probably benign 0.03
R8436:Ifngr1 UTSW 10 19603805 missense probably damaging 1.00
T0975:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
X0005:Ifngr1 UTSW 10 19609473 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGCATGTCTGTCTTTCTAACG -3'
(R):5'- AAACCTTGGAAGTTAGTCGTGTTTC -3'

Sequencing Primer
(F):5'- AACGTCATCTGATCAGGTTTTCTG -3'
(R):5'- GAAGTTAGTCGTGTTTCTCCAC -3'
Posted On2015-07-21