Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Atad5'

330277

Institutional Source

Beutler Lab

Gene Symbol

Atad5

Ensembl Gene

ENSMUSG00000017550

Gene Name

ATPase family, AAA domain containing 5

Synonyms

LOC237877, C130052G03Rik

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80089400-80135794 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 80100311 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]

Predicted Effect

probably null
Transcript: ENSMUST00000017694

SMART Domains

Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1111	1347	5.14e-5	SMART
Blast:AAA	1409	1526	1e-31	BLAST
low complexity region	1573	1583	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108239

SMART Domains

Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1108	1344	5.14e-5	SMART
Blast:AAA	1406	1523	1e-31	BLAST
low complexity region	1570	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151815

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154168

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Atad5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Atad5	APN	11	80132858	missense	probably benign	0.22
IGL00916:Atad5	APN	11	80119000	missense	probably damaging	1.00
IGL01348:Atad5	APN	11	80095564	missense	probably benign	0.00
IGL01601:Atad5	APN	11	80095517	missense	probably benign	0.45
IGL01916:Atad5	APN	11	80112839	critical splice donor site	probably null
IGL02028:Atad5	APN	11	80134110	missense	probably benign	0.20
IGL02095:Atad5	APN	11	80094707	missense	probably benign	0.24
IGL02142:Atad5	APN	11	80094197	missense	probably benign	0.00
IGL02206:Atad5	APN	11	80094183	missense	probably damaging	1.00
IGL02385:Atad5	APN	11	80094627	missense	probably benign	0.04
IGL02858:Atad5	APN	11	80089775	missense	probably damaging	1.00
IGL02962:Atad5	APN	11	80108579	missense	possibly damaging	0.86
PIT4362001:Atad5	UTSW	11	80111567	missense	probably benign	0.04
R0040:Atad5	UTSW	11	80098014	missense	probably benign
R0157:Atad5	UTSW	11	80089817	missense	possibly damaging	0.74
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0319:Atad5	UTSW	11	80120790	splice site	probably benign
R0401:Atad5	UTSW	11	80120699	missense	probably benign	0.11
R0426:Atad5	UTSW	11	80112832	missense	probably benign	0.14
R0452:Atad5	UTSW	11	80106421	missense	probably damaging	0.98
R0496:Atad5	UTSW	11	80100356	missense	probably benign	0.08
R1691:Atad5	UTSW	11	80095532	missense	probably benign	0.00
R1812:Atad5	UTSW	11	80133047	missense	probably damaging	0.98
R2070:Atad5	UTSW	11	80098052	splice site	probably null
R2071:Atad5	UTSW	11	80098052	splice site	probably null
R2153:Atad5	UTSW	11	80106377	missense	probably benign	0.04
R2415:Atad5	UTSW	11	80094251	missense	probably damaging	1.00
R3917:Atad5	UTSW	11	80103294	missense	probably null	0.97
R4025:Atad5	UTSW	11	80120686	missense	probably damaging	1.00
R4561:Atad5	UTSW	11	80095889	missense	probably benign	0.01
R4579:Atad5	UTSW	11	80095191	missense	probably damaging	1.00
R4844:Atad5	UTSW	11	80114311	splice site	probably null
R4853:Atad5	UTSW	11	80095272	missense	probably damaging	1.00
R4873:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R4875:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R5054:Atad5	UTSW	11	80094676	missense	probably benign	0.10
R5226:Atad5	UTSW	11	80095062	missense	probably damaging	0.99
R5397:Atad5	UTSW	11	80111493	missense	probably damaging	1.00
R5449:Atad5	UTSW	11	80124108	missense	probably damaging	1.00
R5571:Atad5	UTSW	11	80111556	missense	probably benign	0.05
R5575:Atad5	UTSW	11	80100323	missense	probably benign	0.02
R5857:Atad5	UTSW	11	80131329	missense	probably benign	0.06
R5927:Atad5	UTSW	11	80127285	missense	probably damaging	1.00
R5928:Atad5	UTSW	11	80094177	missense	probably damaging	1.00
R5949:Atad5	UTSW	11	80096009	nonsense	probably null
R6102:Atad5	UTSW	11	80111572	critical splice donor site	probably null
R6254:Atad5	UTSW	11	80127389	missense	probably damaging	0.96
R6562:Atad5	UTSW	11	80133206	missense	probably benign	0.26
R6744:Atad5	UTSW	11	80134032	missense	probably benign	0.00
R7092:Atad5	UTSW	11	80120720	missense	possibly damaging	0.68
R7202:Atad5	UTSW	11	80089775	missense	probably damaging	1.00
R7345:Atad5	UTSW	11	80096006	missense	probably damaging	1.00
R7352:Atad5	UTSW	11	80103343	critical splice donor site	probably null
R7358:Atad5	UTSW	11	80133036	missense	probably benign	0.32
R7420:Atad5	UTSW	11	80095862	missense	probably benign	0.06
R7453:Atad5	UTSW	11	80119143	critical splice donor site	probably null
R7990:Atad5	UTSW	11	80133253	nonsense	probably null
R8012:Atad5	UTSW	11	80094240	missense	probably damaging	1.00
R8152:Atad5	UTSW	11	80095170	missense	possibly damaging	0.59
R8421:Atad5	UTSW	11	80094558	missense	probably damaging	0.98
RF003:Atad5	UTSW	11	80111560	missense	probably damaging	0.99
X0024:Atad5	UTSW	11	80132783	missense	probably benign	0.02
Z1176:Atad5	UTSW	11	80094896	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTCCCTGGTAAAATTTGAATG -3'
(R):5'- ATGCTTACATCTATCTCTGGCG -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- GACTTCTCCTTTGCAGAACGTG -3'

Posted On

2015-07-21