Incidental Mutation 'R4464:Tkt'
ID 330281
Institutional Source Beutler Lab
Gene Symbol Tkt
Ensembl Gene ENSMUSG00000021957
Gene Name transketolase
Synonyms p68
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4464 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 30548359-30574720 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30568274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 165 (T165A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022529]
AlphaFold P40142
Predicted Effect probably benign
Transcript: ENSMUST00000022529
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Transketolase_N 14 284 1.4e-46 PFAM
Pfam:E1_dh 108 239 6.9e-11 PFAM
Transket_pyr 315 479 1.52e-42 SMART
Pfam:Transketolase_C 490 612 3.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223633
Predicted Effect possibly damaging
Transcript: ENSMUST00000223717
AA Change: T165A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225857
Meta Mutation Damage Score 0.0881 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Tkt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tkt APN 14 30569095 missense probably damaging 1.00
IGL02122:Tkt APN 14 30571201 missense possibly damaging 0.95
IGL02323:Tkt APN 14 30571035 missense possibly damaging 0.69
IGL02326:Tkt APN 14 30572225 missense probably damaging 0.99
IGL02554:Tkt APN 14 30558780 missense probably damaging 1.00
IGL03145:Tkt APN 14 30560688 splice site probably benign
R0148:Tkt UTSW 14 30572220 missense probably damaging 1.00
R0732:Tkt UTSW 14 30571140 splice site probably null
R1550:Tkt UTSW 14 30565568 missense probably damaging 1.00
R2218:Tkt UTSW 14 30567061 critical splice donor site probably null
R4771:Tkt UTSW 14 30567025 missense probably damaging 0.97
R4998:Tkt UTSW 14 30565542 nonsense probably null
R5123:Tkt UTSW 14 30565646 missense probably benign 0.11
R5240:Tkt UTSW 14 30565678 missense probably damaging 1.00
R5283:Tkt UTSW 14 30560618 missense probably damaging 1.00
R5777:Tkt UTSW 14 30558776 missense possibly damaging 0.88
R6051:Tkt UTSW 14 30568196 missense probably benign 0.27
R6517:Tkt UTSW 14 30549323 missense probably damaging 0.96
R6645:Tkt UTSW 14 30570211 missense probably damaging 1.00
R6722:Tkt UTSW 14 30569084 missense probably damaging 1.00
R7120:Tkt UTSW 14 30559822 missense probably benign 0.03
R7179:Tkt UTSW 14 30559858 missense probably damaging 1.00
R7272:Tkt UTSW 14 30565607 missense probably damaging 1.00
R7274:Tkt UTSW 14 30569145 splice site probably null
R7402:Tkt UTSW 14 30558798 missense probably damaging 1.00
R7423:Tkt UTSW 14 30571035 missense possibly damaging 0.69
R7522:Tkt UTSW 14 30568223 missense possibly damaging 0.52
R7712:Tkt UTSW 14 30558806 missense probably benign 0.00
R8975:Tkt UTSW 14 30566927 intron probably benign
R9487:Tkt UTSW 14 30559838 missense probably benign 0.33
R9487:Tkt UTSW 14 30559839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTTTGCTGTGACACCAC -3'
(R):5'- GCTCTTAGGCCACACTCATC -3'

Sequencing Primer
(F):5'- GCTGTGACACCACTGTTGC -3'
(R):5'- CCCCCAGAAGGCACATCTTG -3'
Posted On 2015-07-21