Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Tkt'

330281

Institutional Source

Beutler Lab

Gene Symbol

Tkt

Ensembl Gene

ENSMUSG00000021957

Gene Name

transketolase

Synonyms

p68

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30548359-30574720 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30568274 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 165 (T165A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022529]

Predicted Effect

probably benign
Transcript: ENSMUST00000022529
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022529
Gene: ENSMUSG00000021957
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Transketolase_N	14	284	1.4e-46	PFAM
Pfam:E1_dh	108	239	6.9e-11	PFAM
Transket_pyr	315	479	1.52e-42	SMART
Pfam:Transketolase_C	490	612	3.9e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160406

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223633

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223717
AA Change: T165A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225857

Meta Mutation Damage Score

0.0881

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: This gene encodes an enzyme that binds magnesium and thiamine pyrophosphate and catalyzes the transfer of sugar phosphates to an aldose acceptor. This enzyme is a key component of the pentose phosphate pathway during glycolysis. It is significantly expressed in the cornea and may be involved in the cellular response against oxidative stress. Haploinsufficiency of this gene leads to decreased growth and reduction of adipose tissue. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation die at or before the morula stage. Heterozygotes show reduced growth, decreased fat accumulation, microphthalmia, and reduced female fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Tkt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tkt	APN	14	30569095	missense	probably damaging	1.00
IGL02122:Tkt	APN	14	30571201	missense	possibly damaging	0.95
IGL02323:Tkt	APN	14	30571035	missense	possibly damaging	0.69
IGL02326:Tkt	APN	14	30572225	missense	probably damaging	0.99
IGL02554:Tkt	APN	14	30558780	missense	probably damaging	1.00
IGL03145:Tkt	APN	14	30560688	splice site	probably benign
R0148:Tkt	UTSW	14	30572220	missense	probably damaging	1.00
R0732:Tkt	UTSW	14	30571140	splice site	probably null
R1550:Tkt	UTSW	14	30565568	missense	probably damaging	1.00
R2218:Tkt	UTSW	14	30567061	critical splice donor site	probably null
R4771:Tkt	UTSW	14	30567025	missense	probably damaging	0.97
R4998:Tkt	UTSW	14	30565542	nonsense	probably null
R5123:Tkt	UTSW	14	30565646	missense	probably benign	0.11
R5240:Tkt	UTSW	14	30565678	missense	probably damaging	1.00
R5283:Tkt	UTSW	14	30560618	missense	probably damaging	1.00
R5777:Tkt	UTSW	14	30558776	missense	possibly damaging	0.88
R6051:Tkt	UTSW	14	30568196	missense	probably benign	0.27
R6517:Tkt	UTSW	14	30549323	missense	probably damaging	0.96
R6645:Tkt	UTSW	14	30570211	missense	probably damaging	1.00
R6722:Tkt	UTSW	14	30569084	missense	probably damaging	1.00
R7120:Tkt	UTSW	14	30559822	missense	probably benign	0.03
R7179:Tkt	UTSW	14	30559858	missense	probably damaging	1.00
R7272:Tkt	UTSW	14	30565607	missense	probably damaging	1.00
R7274:Tkt	UTSW	14	30569145	splice site	probably null
R7402:Tkt	UTSW	14	30558798	missense	probably damaging	1.00
R7423:Tkt	UTSW	14	30571035	missense	possibly damaging	0.69
R7522:Tkt	UTSW	14	30568223	missense	possibly damaging	0.52
R7712:Tkt	UTSW	14	30558806	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTCCTTTGCTGTGACACCAC -3'
(R):5'- GCTCTTAGGCCACACTCATC -3'

Sequencing Primer
(F):5'- GCTGTGACACCACTGTTGC -3'
(R):5'- CCCCCAGAAGGCACATCTTG -3'

Posted On

2015-07-21