Incidental Mutation 'R4464:Rb1'
ID330282
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 73199198 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000171767]
Predicted Effect probably damaging
Transcript: ENSMUST00000022701
AA Change: D876Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: D876Y

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168495
Predicted Effect probably null
Transcript: ENSMUST00000171767
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Meta Mutation Damage Score 0.7779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGTACCACTTTACACTTAGTATG -3'
(R):5'- CTGCTGACTTCAAAATGTGGC -3'

Sequencing Primer
(F):5'- CAAGGTCTCACTATATAGCTGTGGC -3'
(R):5'- GACTTCAAAATGTGGCTATTTAATGG -3'
Posted On2015-07-21