Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Krt86'

330286

Institutional Source

Beutler Lab

Gene Symbol

Krt86

Ensembl Gene

ENSMUSG00000067614

Gene Name

keratin 86

Synonyms

Krt2-10, Khb4, Krt2-11, MHb4

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101473478-101479986 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101473914 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 122 (D122N)

Ref Sequence

ENSEMBL: ENSMUSP00000085365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088049]

Predicted Effect

probably damaging
Transcript: ENSMUST00000088049
AA Change: D122N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: D122N

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	2	102	4.6e-15	PFAM
Filament	105	416	6.92e-148	SMART
low complexity region	420	438	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC

Meta Mutation Damage Score

0.6213

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Olfr109	C	T	17: 37,466,851	S215F	probably damaging	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Krt86

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Krt86	APN	15	101476515	missense	possibly damaging	0.55
IGL00597:Krt86	APN	15	101476226	missense	probably benign	0.01
IGL00776:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00800:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00801:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00857:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00902:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00903:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00939:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL00954:Krt86	APN	15	101473860	missense	probably benign	0.00
IGL01107:Krt86	APN	15	101475425	missense	probably damaging	1.00
IGL01638:Krt86	APN	15	101475472	splice site	probably benign
IGL02711:Krt86	APN	15	101473662	missense	probably damaging	1.00
BB009:Krt86	UTSW	15	101476592	missense	probably damaging	1.00
BB019:Krt86	UTSW	15	101476592	missense	probably damaging	1.00
R0046:Krt86	UTSW	15	101477402	missense	probably benign	0.00
R0193:Krt86	UTSW	15	101479363	splice site	probably benign
R0242:Krt86	UTSW	15	101476573	nonsense	probably null
R0242:Krt86	UTSW	15	101476573	nonsense	probably null
R0607:Krt86	UTSW	15	101479531	missense	unknown
R2139:Krt86	UTSW	15	101473758	missense	probably benign	0.11
R4985:Krt86	UTSW	15	101477265	missense	probably damaging	0.99
R5195:Krt86	UTSW	15	101476933	missense	probably benign	0.10
R5587:Krt86	UTSW	15	101473593	missense	probably benign	0.01
R5600:Krt86	UTSW	15	101476505	missense	probably benign	0.00
R5729:Krt86	UTSW	15	101476548	missense	probably benign	0.18
R5876:Krt86	UTSW	15	101476610	missense	probably damaging	0.98
R6169:Krt86	UTSW	15	101476289	missense	probably damaging	1.00
R6776:Krt86	UTSW	15	101476936	missense	probably benign	0.29
R6990:Krt86	UTSW	15	101473833	missense	probably benign	0.03
R7111:Krt86	UTSW	15	101476617	missense	possibly damaging	0.90
R7932:Krt86	UTSW	15	101476592	missense	probably damaging	1.00
R8462:Krt86	UTSW	15	101479403	missense	probably benign	0.00
Z1177:Krt86	UTSW	15	101476897	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCTCTGCAGCTCCCTACAG -3'
(R):5'- GTAGTCAGTTTGTACCCAGGAC -3'

Sequencing Primer
(F):5'- ATCTCCTGCTACCGAGGAC -3'
(R):5'- GACAGCCTGGCCACTTCTC -3'

Posted On

2015-07-21