Incidental Mutation 'R4464:Krt86'
ID 330286
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Name keratin 86
Synonyms Krt2-10, Khb4, Krt2-11, MHb4
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4464 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101473478-101479986 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101473914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 122 (D122N)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
AlphaFold P97861
Predicted Effect probably damaging
Transcript: ENSMUST00000088049
AA Change: D122N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: D122N

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Meta Mutation Damage Score 0.6213 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
BB009:Krt86 UTSW 15 101476592 missense probably damaging 1.00
BB019:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4985:Krt86 UTSW 15 101477265 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5600:Krt86 UTSW 15 101476505 missense probably benign 0.00
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R5876:Krt86 UTSW 15 101476610 missense probably damaging 0.98
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
R7111:Krt86 UTSW 15 101476617 missense possibly damaging 0.90
R7932:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R8462:Krt86 UTSW 15 101479403 missense probably benign 0.00
R8956:Krt86 UTSW 15 101477276 missense probably benign 0.03
Z1177:Krt86 UTSW 15 101476897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTCTGCAGCTCCCTACAG -3'
(R):5'- GTAGTCAGTTTGTACCCAGGAC -3'

Sequencing Primer
(F):5'- ATCTCCTGCTACCGAGGAC -3'
(R):5'- GACAGCCTGGCCACTTCTC -3'
Posted On 2015-07-21