Incidental Mutation 'R4464:Gm7535'
ID330287
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Namepredicted gene 7535
Synonyms
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17911039-17911947 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 17911662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Meta Mutation Damage Score 0.2981 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rad51ap1 T C 6: 126,934,768 N52S possibly damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 17911888 intron probably benign
IGL01663:Gm7535 APN 17 17911357 intron probably benign
R0165:Gm7535 UTSW 17 17911175 intron probably benign
R0335:Gm7535 UTSW 17 17911112 intron probably benign
R1985:Gm7535 UTSW 17 17911538 intron probably benign
R2217:Gm7535 UTSW 17 17911674 intron probably benign
R2218:Gm7535 UTSW 17 17911674 intron probably benign
R4581:Gm7535 UTSW 17 17911083 intron probably benign
R4887:Gm7535 UTSW 17 17911071 intron probably benign
R5225:Gm7535 UTSW 17 17911547 intron probably benign
R5305:Gm7535 UTSW 17 17911799 intron probably benign
R5641:Gm7535 UTSW 17 17911526 intron probably benign
R5658:Gm7535 UTSW 17 17911320 intron probably benign
R5760:Gm7535 UTSW 17 17911818 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCGAACCAGCTCCTTGTATC -3'
(R):5'- CTATTCTGTGCCACCTGGTG -3'

Sequencing Primer
(F):5'- TCTGCATCAAGGTCAGCAG -3'
(R):5'- ACCTGGTGTGGAGGAGGC -3'
Posted On2015-07-21