Mutagenetix > Incidental Mutations

Incidental Mutation 'R4464:Olfr109'

330288

Institutional Source

Beutler Lab

Gene Symbol

Olfr109

Ensembl Gene

ENSMUSG00000029184

Gene Name

olfactory receptor 109

Synonyms

GA_x6K02T2PSCP-1914078-1915022, MOR250-1

MMRRC Submission

041722-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R4464 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37458916-37471590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 37466851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 215 (S215F)

Ref Sequence

ENSEMBL: ENSMUSP00000150044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]

AlphaFold

Q8VG96

Predicted Effect

probably damaging
Transcript: ENSMUST00000031086
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: S215F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	309	3.4e-54	PFAM
Pfam:7tm_1	39	291	6.3e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214668
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214938
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217602
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4392

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
Abcc3	A	G	11: 94,358,786	V1111A	probably benign	Het
Acot10	G	A	15: 20,665,744	R304*	probably null	Het
Aldh8a1	C	A	10: 21,388,941		probably benign	Het
Alms1	A	G	6: 85,620,021	T1079A	possibly damaging	Het
Armc3	T	C	2: 19,248,659	Y204H	probably damaging	Het
Asnsd1	C	A	1: 53,352,527		probably null	Het
Atad5	T	A	11: 80,100,311		probably null	Het
Cst12	G	A	2: 148,789,517	V53I	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dennd1a	A	T	2: 38,243,390		probably benign	Het
Fam213a	T	A	14: 40,997,875	K127N	probably damaging	Het
Gm7535	C	A	17: 17,911,662		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Ifngr1	G	A	10: 19,597,517	V72I	possibly damaging	Het
Kifap3	C	A	1: 163,817,895	Q269K	probably benign	Het
Krt86	G	A	15: 101,473,914	D122N	probably damaging	Het
Lrrcc1	A	G	3: 14,557,318	K694E	probably damaging	Het
Mbd4	A	G	6: 115,849,502	L155S	probably damaging	Het
Nalcn	T	C	14: 123,323,350	N772D	probably benign	Het
Psg29	A	T	7: 17,210,650	N362Y	possibly damaging	Het
Ptpn23	G	A	9: 110,386,813	T1325I	probably damaging	Het
Rad51ap1	T	C	6: 126,934,768	N52S	possibly damaging	Het
Rb1	C	A	14: 73,199,198		probably null	Het
Slc34a2	T	C	5: 53,069,182	L490P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
St3gal2	A	G	8: 110,967,502	N207D	probably benign	Het
Stat1	T	G	1: 52,137,416	D257E	possibly damaging	Het
Tkt	A	G	14: 30,568,274	T165A	possibly damaging	Het
Trim66	A	T	7: 109,477,690	S347R	possibly damaging	Het
Zfp429	T	C	13: 67,390,498	I276V	probably benign	Het

Other mutations in Olfr109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01813:Olfr109	APN	17	37466758	missense	probably damaging	1.00
IGL02039:Olfr109	APN	17	37466449	missense	possibly damaging	0.49
IGL02391:Olfr109	APN	17	37466586	missense	probably damaging	1.00
IGL02730:Olfr109	APN	17	37466859	missense	probably damaging	1.00
IGL02751:Olfr109	APN	17	37466415	missense	probably damaging	0.98
IGL02891:Olfr109	APN	17	37466944	missense	probably damaging	1.00
IGL03023:Olfr109	APN	17	37466994	missense	probably benign
IGL03343:Olfr109	APN	17	37466409	missense	probably damaging	1.00
R0026:Olfr109	UTSW	17	37466803	missense	probably damaging	0.99
R0579:Olfr109	UTSW	17	37466347	missense	probably benign	0.01
R1751:Olfr109	UTSW	17	37466901	missense	probably benign	0.00
R1848:Olfr109	UTSW	17	37467047	missense	probably damaging	0.99
R2392:Olfr109	UTSW	17	37466419	missense	probably damaging	1.00
R4249:Olfr109	UTSW	17	37466824	missense	probably damaging	0.98
R4857:Olfr109	UTSW	17	37466823	missense	possibly damaging	0.80
R4947:Olfr109	UTSW	17	37466743	missense	probably damaging	1.00
R5107:Olfr109	UTSW	17	37466253	missense	probably damaging	0.97
R5526:Olfr109	UTSW	17	37467112	missense	unknown
R6147:Olfr109	UTSW	17	37466539	missense	probably benign	0.00
R6416:Olfr109	UTSW	17	37467080	nonsense	probably null
R7450:Olfr109	UTSW	17	37466616	missense	probably benign	0.00
R7487:Olfr109	UTSW	17	37466566	missense	probably damaging	0.96
R7822:Olfr109	UTSW	17	37467103	missense	probably benign	0.00
R8041:Olfr109	UTSW	17	37466649	missense	probably benign
R8051:Olfr109	UTSW	17	37466322	missense	probably damaging	1.00
R9013:Olfr109	UTSW	17	37466550	missense	probably benign	0.13
X0063:Olfr109	UTSW	17	37466524	missense	probably damaging	1.00
X0065:Olfr109	UTSW	17	37466318	missense	probably damaging	1.00
Z1176:Olfr109	UTSW	17	37466661	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCATTCTGTCATGACTGCTCAC -3'
(R):5'- ATATCAGTGGGTTCAGCACTGG -3'

Sequencing Primer
(F):5'- GTCATGACTGCTCACTTGAAC -3'
(R):5'- ACTGCACTGTAGATGATGGCCAC -3'

Posted On

2015-07-21