Incidental Mutation 'R4465:Olfr1097'
List |< first << previous [record 21 of 32] next >> last >|
ID330292
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86891150 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 8 (N8K)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect probably benign
Transcript: ENSMUST00000111576
AA Change: N8K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: N8K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217403
AA Change: N8K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0042:Olfr1097 UTSW 2 86890491 missense probably damaging 1.00
R0605:Olfr1097 UTSW 2 86890419 missense possibly damaging 0.65
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R2412:Olfr1097 UTSW 2 86890834 missense probably benign 0.01
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R5847:Olfr1097 UTSW 2 86890332 missense probably damaging 0.99
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7256:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGGAGGTCAGCGTATTCTGTAAG -3'
(R):5'- GATCAGCTAAACTTTCAACTGCAAC -3'

Sequencing Primer
(F):5'- TTTAGGTGTGATTACAGTTGAGTAAC -3'
(R):5'- GGAAGACCTTTAAACACTTATGT -3'
Posted On2015-07-21