Incidental Mutation 'R4465:Mup6'
List |< first << previous [record 18 of 32] next >> last >|
ID330295
Institutional Source Beutler Lab
Gene Symbol Mup6
Ensembl Gene ENSMUSG00000078689
Gene Namemajor urinary protein 6
SynonymsGm12544
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4465 (G1)
Quality Score208
Status Not validated
Chromosome4
Chromosomal Location59964294-60007274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60004000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000103145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107517] [ENSMUST00000107520] [ENSMUST00000107521]
Predicted Effect probably damaging
Transcript: ENSMUST00000107517
AA Change: I39T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103141
Gene: ENSMUSG00000078689
AA Change: I39T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107520
AA Change: I39T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103144
Gene: ENSMUSG00000078689
AA Change: I39T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107521
AA Change: I31T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103145
Gene: ENSMUSG00000078689
AA Change: I31T

DomainStartEndE-ValueType
Pfam:Lipocalin 25 164 1.4e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Mup6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Mup6 APN 4 60006001 missense probably damaging 1.00
IGL01333:Mup6 APN 4 60005529 missense probably damaging 1.00
IGL01608:Mup6 APN 4 60006021 missense probably benign 0.34
IGL02471:Mup6 APN 4 60003971 splice site probably benign
IGL02932:Mup6 APN 4 60006009 missense probably damaging 1.00
IGL03070:Mup6 APN 4 60003999 missense probably damaging 1.00
IGL03108:Mup6 APN 4 60005990 missense possibly damaging 0.55
IGL03158:Mup6 APN 4 60005480 missense possibly damaging 0.83
R0122:Mup6 UTSW 4 60003995 nonsense probably null
R1271:Mup6 UTSW 4 60003579 intron probably benign
R3434:Mup6 UTSW 4 60004116 splice site probably null
R3435:Mup6 UTSW 4 60004116 splice site probably null
R4258:Mup6 UTSW 4 60004812 critical splice acceptor site probably null
R4466:Mup6 UTSW 4 60004000 missense probably damaging 1.00
R5021:Mup6 UTSW 4 59964352 missense probably damaging 0.99
R5272:Mup6 UTSW 4 60005922 missense probably damaging 0.99
R6396:Mup6 UTSW 4 60004837 missense possibly damaging 0.84
R6861:Mup6 UTSW 4 60004093 missense probably benign 0.02
R7818:Mup6 UTSW 4 60004884 missense probably benign 0.05
R8238:Mup6 UTSW 4 60003634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTCACTGAGAGGTAGGGAC -3'
(R):5'- ACAGACTCAGTATGTGTGTACAC -3'

Sequencing Primer
(F):5'- CAGCATGGTAAGTATTGTGACAACTG -3'
(R):5'- CCCCCTATCTGAGTGTTTGTAGG -3'
Posted On2015-07-21