Incidental Mutation 'R4465:Lao1'
ID330297
Institutional Source Beutler Lab
Gene Symbol Lao1
Ensembl Gene ENSMUSG00000024903
Gene NameL-amino acid oxidase 1
Synonyms
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118961578-118968912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118965307 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 141 (S141R)
Ref Sequence ENSEMBL: ENSMUSP00000062834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058651]
Predicted Effect probably benign
Transcript: ENSMUST00000058651
AA Change: S141R

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062834
Gene: ENSMUSG00000024903
AA Change: S141R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pyr_redox_2 39 133 1.9e-8 PFAM
Pfam:HI0933_like 58 98 2.2e-7 PFAM
Pfam:FAD_binding_2 59 99 2.2e-7 PFAM
Pfam:Pyr_redox 59 106 5.4e-7 PFAM
Pfam:NAD_binding_8 62 129 8.1e-15 PFAM
Pfam:Amino_oxidase 67 509 3.1e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142457
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show alterations in the free amino acid composition and antibacterial activity of milk and increased susceptibility to intramammary bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Lao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Lao1 APN 4 118968443 missense probably damaging 0.97
IGL02252:Lao1 APN 4 118967416 missense probably benign 0.19
R0139:Lao1 UTSW 4 118964202 missense probably benign 0.06
R0541:Lao1 UTSW 4 118963802 missense probably benign 0.03
R0635:Lao1 UTSW 4 118968296 missense probably benign 0.04
R1164:Lao1 UTSW 4 118965405 missense probably benign 0.00
R4767:Lao1 UTSW 4 118967988 missense probably damaging 1.00
R4950:Lao1 UTSW 4 118965375 missense probably damaging 1.00
R5061:Lao1 UTSW 4 118967476 missense probably benign 0.00
R5488:Lao1 UTSW 4 118967369 missense probably damaging 1.00
R5644:Lao1 UTSW 4 118965236 splice site probably null
R6176:Lao1 UTSW 4 118962000 start codon destroyed probably null 0.40
R6189:Lao1 UTSW 4 118967880 missense probably benign 0.00
R6857:Lao1 UTSW 4 118963826 critical splice donor site probably null
R6859:Lao1 UTSW 4 118963751 missense probably damaging 0.99
R7074:Lao1 UTSW 4 118968185 missense probably damaging 1.00
R7878:Lao1 UTSW 4 118967422 missense probably benign 0.00
R7961:Lao1 UTSW 4 118967422 missense probably benign 0.00
R8021:Lao1 UTSW 4 118968477 missense probably damaging 0.99
X0021:Lao1 UTSW 4 118968522 missense probably benign 0.00
Z1176:Lao1 UTSW 4 118968440 missense probably damaging 1.00
Z1177:Lao1 UTSW 4 118968371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCACAACATTTAATGAGATTGC -3'
(R):5'- TGTAACCTTAGGCACCACCC -3'

Sequencing Primer
(F):5'- GCAATTGAACAAGCAATCAGTTTGAG -3'
(R):5'- GTAACCTTAGGCACCACCCATTTC -3'
Posted On2015-07-21