Incidental Mutation 'R4465:Slc5a1'
List [record 1 of 32] next >> last >|
ID330299
Institutional Source Beutler Lab
Gene Symbol Slc5a1
Ensembl Gene ENSMUSG00000011034
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 1
SynonymsSglt1, sodium glucose cotransporter 1
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33104219-33162870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33146516 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000011178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011178
AA Change: E225G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: E225G

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 2.6e-174 PFAM
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202802
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Slc5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Slc5a1 APN 5 33160865 missense probably benign
IGL01872:Slc5a1 APN 5 33154637 missense probably damaging 0.97
IGL01906:Slc5a1 APN 5 33154653 missense probably damaging 1.00
IGL02614:Slc5a1 APN 5 33154601 missense probably benign 0.02
IGL03241:Slc5a1 APN 5 33133405 missense probably benign 0.00
IGL03336:Slc5a1 APN 5 33146943 missense probably benign 0.24
R0314:Slc5a1 UTSW 5 33146651 missense probably benign 0.02
R0421:Slc5a1 UTSW 5 33134652 missense probably damaging 1.00
R0755:Slc5a1 UTSW 5 33133389 missense probably benign 0.14
R0791:Slc5a1 UTSW 5 33158077 splice site probably benign
R1506:Slc5a1 UTSW 5 33154708 missense possibly damaging 0.72
R1801:Slc5a1 UTSW 5 33146953 missense probably damaging 1.00
R2143:Slc5a1 UTSW 5 33160796 missense probably benign
R2190:Slc5a1 UTSW 5 33104593 critical splice donor site probably null
R3796:Slc5a1 UTSW 5 33152652 missense probably damaging 1.00
R4423:Slc5a1 UTSW 5 33154674 missense possibly damaging 0.49
R4588:Slc5a1 UTSW 5 33145288 missense probably benign 0.01
R4722:Slc5a1 UTSW 5 33146711 missense possibly damaging 0.86
R4826:Slc5a1 UTSW 5 33159150 missense probably benign
R4934:Slc5a1 UTSW 5 33104514 missense probably benign
R4955:Slc5a1 UTSW 5 33160902 missense probably benign 0.02
R4963:Slc5a1 UTSW 5 33160782 missense probably benign 0.00
R5008:Slc5a1 UTSW 5 33152573 missense possibly damaging 0.75
R5094:Slc5a1 UTSW 5 33158280 missense probably damaging 1.00
R5292:Slc5a1 UTSW 5 33158241 missense probably benign
R5654:Slc5a1 UTSW 5 33146611 missense probably benign 0.00
R6784:Slc5a1 UTSW 5 33158116 missense probably benign 0.00
R7585:Slc5a1 UTSW 5 33160944 missense probably damaging 1.00
R7734:Slc5a1 UTSW 5 33160935 missense probably benign
R7751:Slc5a1 UTSW 5 33133417 missense possibly damaging 0.63
R7827:Slc5a1 UTSW 5 33146713 missense probably damaging 1.00
RF020:Slc5a1 UTSW 5 33133429 missense probably damaging 1.00
X0064:Slc5a1 UTSW 5 33134636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGGCACTTCCACAAGTC -3'
(R):5'- CTGATCCGTACACCAGTACC -3'

Sequencing Primer
(F):5'- GGGCACTTCCACAAGTCATTGC -3'
(R):5'- GTACACCAGTACCACAGGGCG -3'
Posted On2015-07-21