Incidental Mutation 'R4465:Tas2r107'
ID330304
Institutional Source Beutler Lab
Gene Symbol Tas2r107
Ensembl Gene ENSMUSG00000053389
Gene Nametaste receptor, type 2, member 107
SynonymsT2R4, Tas2r7, mGR06, STC 5-1, mt2r43, T2R07
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131659118-131660149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131660009 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 26 (Y26H)
Ref Sequence ENSEMBL: ENSMUSP00000067082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065781]
Predicted Effect probably benign
Transcript: ENSMUST00000065781
AA Change: Y26H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067082
Gene: ENSMUSG00000053389
AA Change: Y26H

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4e-106 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Tas2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Tas2r107 APN 6 131659954 missense probably damaging 1.00
IGL02751:Tas2r107 APN 6 131659484 missense probably damaging 1.00
IGL02868:Tas2r107 APN 6 131659286 missense probably benign 0.11
IGL02943:Tas2r107 APN 6 131659406 missense probably damaging 0.99
R1564:Tas2r107 UTSW 6 131659822 missense probably damaging 0.96
R1905:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1906:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1907:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R2185:Tas2r107 UTSW 6 131659603 missense probably damaging 0.98
R3014:Tas2r107 UTSW 6 131660009 missense probably benign 0.30
R3824:Tas2r107 UTSW 6 131659330 missense probably benign 0.00
R5058:Tas2r107 UTSW 6 131659742 missense probably damaging 1.00
R5646:Tas2r107 UTSW 6 131659708 missense probably benign 0.02
R5975:Tas2r107 UTSW 6 131659780 missense probably benign 0.02
R6008:Tas2r107 UTSW 6 131659912 missense possibly damaging 0.82
R6144:Tas2r107 UTSW 6 131660003 missense possibly damaging 0.87
R6451:Tas2r107 UTSW 6 131660014 missense possibly damaging 0.81
R6662:Tas2r107 UTSW 6 131659489 missense possibly damaging 0.82
R6702:Tas2r107 UTSW 6 131659384 missense probably benign 0.12
R7032:Tas2r107 UTSW 6 131659190 missense possibly damaging 0.62
R7635:Tas2r107 UTSW 6 131659600 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGTTATGTTTCCAGAGGTAAGC -3'
(R):5'- GCACCCATAAAGTTCTGAATCTATCAC -3'

Sequencing Primer
(F):5'- TCCAGAGGTAAGCATGTGTG -3'
(R):5'- CTGAATCTATCACATGACAATAGGC -3'
Posted On2015-07-21