Incidental Mutation 'R4465:Zdhhc22'
List |< first << previous [record 31 of 32] next >> last >|
ID330311
Institutional Source Beutler Lab
Gene Symbol Zdhhc22
Ensembl Gene ENSMUSG00000048483
Gene Namezinc finger, DHHC-type containing 22
SynonymsLOC238331
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R4465 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location86980763-86990430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86988223 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 152 (L152F)
Ref Sequence ENSEMBL: ENSMUSP00000152660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095521] [ENSMUST00000222543]
Predicted Effect probably benign
Transcript: ENSMUST00000095521
AA Change: L152F

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093177
Gene: ENSMUSG00000048483
AA Change: L152F

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:zf-DHHC 79 222 3.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222543
AA Change: L152F

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223336
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Homo
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Zdhhc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Zdhhc22 UTSW 12 86988297 missense probably damaging 0.98
R1836:Zdhhc22 UTSW 12 86983430 missense probably benign 0.31
R2847:Zdhhc22 UTSW 12 86988562 missense probably benign
R3881:Zdhhc22 UTSW 12 86983626 missense probably benign 0.00
R4876:Zdhhc22 UTSW 12 86988238 missense probably damaging 1.00
R5448:Zdhhc22 UTSW 12 86988567 missense possibly damaging 0.95
R7667:Zdhhc22 UTSW 12 86983388 missense probably benign 0.00
R8090:Zdhhc22 UTSW 12 86983620 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTCATACCAAACAACTGTCTATCTG -3'
(R):5'- ATGTCCCAGAGACCTCAGTG -3'

Sequencing Primer
(F):5'- GACTGTTTGAGTCCAGCATCCTG -3'
(R):5'- GAGACCTCAGTGCCCACC -3'
Posted On2015-07-21