Incidental Mutation 'R4466:Crygb'
ID330326
Institutional Source Beutler Lab
Gene Symbol Crygb
Ensembl Gene ENSMUSG00000073658
Gene Namecrystallin, gamma B
SynonymsCryg-3, DGcry-3
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4466 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65080219-65082288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65080486 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000027090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027090]
Predicted Effect probably damaging
Transcript: ENSMUST00000027090
AA Change: S112P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027090
Gene: ENSMUSG00000073658
AA Change: S112P

DomainStartEndE-ValueType
XTALbg 3 82 6.2e-47 SMART
XTALbg 90 171 2.89e-47 SMART
Meta Mutation Damage Score 0.6150 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes and heterozygotes for a spontaneous mutation exhibit cataracts characterized by nuclear and polar opacity with vacuoles and a reduction in lens weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Crygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
inadequate UTSW 1 65080486 missense probably damaging 1.00
L10 UTSW 1 65082157 missense probably damaging 1.00
R0725:Crygb UTSW 1 65081941 missense probably benign 0.00
R1084:Crygb UTSW 1 65080495 missense possibly damaging 0.83
R4952:Crygb UTSW 1 65082109 missense probably benign 0.45
R7288:Crygb UTSW 1 65081925 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCGCCTAAAAGAGCCAACTTTG -3'
(R):5'- TCTGTACCGAGCTTGTTCTG -3'

Sequencing Primer
(F):5'- AACTTTGGCATTTGCAGCC -3'
(R):5'- ACCGAGCTTGTTCTGAATGCAG -3'
Posted On2015-07-21