Incidental Mutation 'R4466:Stk35'
ID 330333
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4466 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 129801516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 140 (T140K)
Ref Sequence ENSEMBL: ENSMUSP00000132862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect probably damaging
Transcript: ENSMUST00000165413
AA Change: T140K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: T140K

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166282
AA Change: T140K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885
AA Change: T140K

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R3872:Stk35 UTSW 2 129810575 missense possibly damaging 0.82
R5144:Stk35 UTSW 2 129810935 missense probably damaging 1.00
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R7476:Stk35 UTSW 2 129810725 missense probably damaging 1.00
R8505:Stk35 UTSW 2 129801729 missense probably damaging 0.99
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R8999:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGACGCTTTAAGTTCCTC -3'
(R):5'- ATAAACCACGCCGTAGCTGC -3'

Sequencing Primer
(F):5'- GGACGCTTTAAGTTCCTCATCTAC -3'
(R):5'- TGCAGGAACATCCCCGC -3'
Posted On 2015-07-21