Incidental Mutation 'R4466:Mup6'
ID330338
Institutional Source Beutler Lab
Gene Symbol Mup6
Ensembl Gene ENSMUSG00000078689
Gene Namemajor urinary protein 6
SynonymsGm12544
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4466 (G1)
Quality Score219
Status Validated
Chromosome4
Chromosomal Location59964294-60007274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60004000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000103145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107517] [ENSMUST00000107520] [ENSMUST00000107521]
Predicted Effect probably damaging
Transcript: ENSMUST00000107517
AA Change: I39T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103141
Gene: ENSMUSG00000078689
AA Change: I39T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107520
AA Change: I39T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103144
Gene: ENSMUSG00000078689
AA Change: I39T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lipocalin 33 172 1.6e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107521
AA Change: I31T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103145
Gene: ENSMUSG00000078689
AA Change: I31T

DomainStartEndE-ValueType
Pfam:Lipocalin 25 164 1.4e-35 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Mup6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Mup6 APN 4 60006001 missense probably damaging 1.00
IGL01333:Mup6 APN 4 60005529 missense probably damaging 1.00
IGL01608:Mup6 APN 4 60006021 missense probably benign 0.34
IGL02471:Mup6 APN 4 60003971 splice site probably benign
IGL02932:Mup6 APN 4 60006009 missense probably damaging 1.00
IGL03070:Mup6 APN 4 60003999 missense probably damaging 1.00
IGL03108:Mup6 APN 4 60005990 missense possibly damaging 0.55
IGL03158:Mup6 APN 4 60005480 missense possibly damaging 0.83
R0122:Mup6 UTSW 4 60003995 nonsense probably null
R1271:Mup6 UTSW 4 60003579 intron probably benign
R3434:Mup6 UTSW 4 60004116 splice site probably null
R3435:Mup6 UTSW 4 60004116 splice site probably null
R4258:Mup6 UTSW 4 60004812 critical splice acceptor site probably null
R4465:Mup6 UTSW 4 60004000 missense probably damaging 1.00
R5021:Mup6 UTSW 4 59964352 missense probably damaging 0.99
R5272:Mup6 UTSW 4 60005922 missense probably damaging 0.99
R6396:Mup6 UTSW 4 60004837 missense possibly damaging 0.84
R6861:Mup6 UTSW 4 60004093 missense probably benign 0.02
R7818:Mup6 UTSW 4 60004884 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGACCTTGAAGTAAGACCAGC -3'
(R):5'- TGAGAGACCATACCAGGTTTTC -3'

Sequencing Primer
(F):5'- AGGACCTCTGTTCTCACTGAGAG -3'
(R):5'- CCTTTCCTGTTTGTCAGCTAGGAG -3'
Posted On2015-07-21