Incidental Mutation 'R4466:M6pr'
ID330348
Institutional Source Beutler Lab
Gene Symbol M6pr
Ensembl Gene ENSMUSG00000007458
Gene Namemannose-6-phosphate receptor, cation dependent
SynonymsMpr46, CD-MPR
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4466 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122308720-122317680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122313269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000108229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000160696] [ENSMUST00000161054] [ENSMUST00000161739]
Predicted Effect probably benign
Transcript: ENSMUST00000007602
AA Change: T64A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458
AA Change: T64A

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079560
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081849
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112610
AA Change: T64A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458
AA Change: T64A

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123093
Predicted Effect probably benign
Transcript: ENSMUST00000159252
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160696
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161054
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161739
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Meta Mutation Damage Score 0.1716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and display no visible phenotypic abnormalities; however, serum levels of lysosomal enzymes are elevated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in M6pr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:M6pr APN 6 122313378 missense probably damaging 0.99
IGL00899:M6pr APN 6 122315395 missense possibly damaging 0.60
IGL01291:M6pr APN 6 122312259 missense probably benign 0.08
IGL02010:M6pr APN 6 122315126 missense possibly damaging 0.70
IGL02200:M6pr APN 6 122315068 missense probably benign 0.25
ANU05:M6pr UTSW 6 122312259 missense probably benign 0.08
R1559:M6pr UTSW 6 122315074 missense probably benign 0.06
R2015:M6pr UTSW 6 122313373 missense probably damaging 0.99
R2144:M6pr UTSW 6 122315367 missense probably benign 0.04
R4402:M6pr UTSW 6 122315023 unclassified probably benign
R5270:M6pr UTSW 6 122315089 missense possibly damaging 0.90
R6306:M6pr UTSW 6 122315162 unclassified probably null
R6393:M6pr UTSW 6 122315380 missense possibly damaging 0.56
R6583:M6pr UTSW 6 122313390 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGTGGGGAAACAGCTAACAC -3'
(R):5'- TGACTTGGGATTAGTCAGCAG -3'

Sequencing Primer
(F):5'- GTGGGGAAACAGCTAACACTTTTATG -3'
(R):5'- CTTGGGATTAGTCAGCAGGAAATATC -3'
Posted On2015-07-21