Mutagenetix > Incidental Mutation

Incidental Mutation 'R4466:Atm'

330357

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

041723-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R4466 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 53448169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 2778 (E2778*)

Ref Sequence

ENSEMBL: ENSMUSP00000156344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000118282
AA Change: E2775*

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: E2775*

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132249
AA Change: E117*

SMART Domains

Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218
AA Change: E117*

Domain	Start	End	E-Value	Type
PI3Kc	68	201	5.38e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000232179
AA Change: E2778*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449A18Rik	A	T	3: 59,838,466 (GRCm38)		noncoding transcript	Het
Adgra1	T	A	7: 139,840,836 (GRCm38)		probably benign	Het
Akap13	T	A	7: 75,602,773 (GRCm38)		probably null	Het
Amn1	T	C	6: 149,166,845 (GRCm38)		probably null	Het
Ano5	T	A	7: 51,570,275 (GRCm38)	F374I	probably damaging	Het
Apol7c	T	C	15: 77,526,464 (GRCm38)	E94G	probably benign	Het
Arid4b	A	T	13: 14,132,510 (GRCm38)	S117C	probably damaging	Het
Cped1	A	T	6: 22,123,652 (GRCm38)	Q468L	probably benign	Het
Crygb	A	G	1: 65,080,486 (GRCm38)	S112P	probably damaging	Het
Eml4	C	T	17: 83,421,674 (GRCm38)	Q93*	probably null	Het
Eps15	G	A	4: 109,366,530 (GRCm38)		probably benign	Het
Fabp3	C	T	4: 130,312,387 (GRCm38)	T57I	probably benign	Het
Fam102b	T	A	3: 108,979,808 (GRCm38)	R291S	probably benign	Het
Fhad1	A	T	4: 141,957,658 (GRCm38)	S457T	probably damaging	Het
Frmd4b	A	G	6: 97,323,653 (GRCm38)		probably null	Het
Gm5134	G	C	10: 76,008,575 (GRCm38)	K588N	probably benign	Het
Gpr21	A	G	2: 37,517,558 (GRCm38)	T39A	probably benign	Het
Irx1	C	A	13: 71,959,982 (GRCm38)	G194W	probably damaging	Het
Itgal	C	T	7: 127,328,512 (GRCm38)	T992I	possibly damaging	Het
Itpr3	T	C	17: 27,106,342 (GRCm38)	L1303P	probably damaging	Het
Kdm2a	A	T	19: 4,320,300 (GRCm38)	D1052E	probably damaging	Het
Klhl6	T	C	16: 19,957,268 (GRCm38)	D180G	probably damaging	Het
M6pr	A	G	6: 122,313,269 (GRCm38)	T64A	probably benign	Het
Mrpl47	G	A	3: 32,730,091 (GRCm38)	R177*	probably null	Het
Mtfr2	A	G	10: 20,348,413 (GRCm38)	Y31C	probably damaging	Het
Mup6	T	C	4: 60,004,000 (GRCm38)	I31T	probably damaging	Het
Oas2	A	G	5: 120,749,602 (GRCm38)	S58P	probably damaging	Het
Olfr1489	G	A	19: 13,633,437 (GRCm38)	E109K	probably damaging	Het
Olfr339	A	T	2: 36,422,296 (GRCm38)	R299S	probably benign	Het
Olfr883	T	A	9: 38,026,183 (GRCm38)	C126S	probably damaging	Het
Polr1b	A	T	2: 129,123,882 (GRCm38)	I815L	probably benign	Het
Psma8	T	C	18: 14,721,174 (GRCm38)	I37T	possibly damaging	Het
Ryr3	T	C	2: 112,653,102 (GRCm38)	E4100G	possibly damaging	Het
Serpina3g	C	T	12: 104,237,923 (GRCm38)		probably benign	Het
Serpina3m	A	T	12: 104,391,615 (GRCm38)	Y266F	probably damaging	Het
Sez6l2	T	A	7: 126,959,851 (GRCm38)	D423E	probably damaging	Het
Sh3gl2	A	G	4: 85,381,451 (GRCm38)	E224G	possibly damaging	Het
Sh3pxd2a	A	G	19: 47,364,707 (GRCm38)	V105A	possibly damaging	Het
Slc24a2	A	T	4: 87,227,862 (GRCm38)		probably benign	Het
Smyd2	A	G	1: 189,882,152 (GRCm38)	M393T	probably benign	Het
Sox8	C	A	17: 25,568,905 (GRCm38)	G190V	probably benign	Het
Stag2	A	G	X: 42,233,872 (GRCm38)	S400G	probably benign	Het
Stk35	C	A	2: 129,801,516 (GRCm38)	T140K	probably damaging	Het
Taf6	A	C	5: 138,181,201 (GRCm38)		probably benign	Het
Ten1	A	C	11: 116,204,997 (GRCm38)		probably benign	Het
Tmem181a	T	A	17: 6,295,786 (GRCm38)	L185H	probably damaging	Het
Ttn	A	G	2: 76,713,700 (GRCm38)	F32981L	probably damaging	Het
Zik1	G	T	7: 10,490,966 (GRCm38)	T68K	probably benign	Het
Zzef1	T	A	11: 72,924,659 (GRCm38)	I2935N	probably damaging	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53,524,443 (GRCm38)	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53,499,112 (GRCm38)	splice site	probably benign
IGL00567:Atm	APN	9	53,503,116 (GRCm38)	nonsense	probably null
IGL00702:Atm	APN	9	53,511,831 (GRCm38)	missense	probably benign	0.02
IGL00743:Atm	APN	9	53,513,116 (GRCm38)	missense	probably benign	0.00
IGL00771:Atm	APN	9	53,493,054 (GRCm38)	missense	probably benign	0.01
IGL00773:Atm	APN	9	53,522,144 (GRCm38)	missense	probably benign	0.00
IGL00819:Atm	APN	9	53,518,531 (GRCm38)	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53,533,933 (GRCm38)	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53,459,816 (GRCm38)	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53,490,293 (GRCm38)	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53,461,122 (GRCm38)	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53,515,317 (GRCm38)	missense	probably benign
IGL01374:Atm	APN	9	53,531,724 (GRCm38)	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53,439,746 (GRCm38)	makesense	probably null
IGL01409:Atm	APN	9	53,499,171 (GRCm38)	missense	probably benign	0.01
IGL01434:Atm	APN	9	53,507,807 (GRCm38)	missense	probably benign	0.04
IGL01486:Atm	APN	9	53,510,213 (GRCm38)	missense	probably benign
IGL01583:Atm	APN	9	53,484,247 (GRCm38)	splice site	probably benign
IGL01861:Atm	APN	9	53,494,612 (GRCm38)	missense	probably null	0.89
IGL01865:Atm	APN	9	53,461,002 (GRCm38)	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53,442,417 (GRCm38)	splice site	probably null
IGL02072:Atm	APN	9	53,459,796 (GRCm38)	missense	probably benign	0.01
IGL02075:Atm	APN	9	53,527,237 (GRCm38)	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53,487,983 (GRCm38)	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53,480,665 (GRCm38)	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53,527,185 (GRCm38)	missense	probably benign	0.12
IGL02259:Atm	APN	9	53,518,494 (GRCm38)	splice site	probably benign
IGL02351:Atm	APN	9	53,522,176 (GRCm38)	missense	probably benign	0.04
IGL02358:Atm	APN	9	53,522,176 (GRCm38)	missense	probably benign	0.04
IGL02387:Atm	APN	9	53,479,766 (GRCm38)	splice site	probably null
IGL02417:Atm	APN	9	53,479,695 (GRCm38)	missense	probably benign	0.00
IGL02422:Atm	APN	9	53,500,792 (GRCm38)	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53,454,330 (GRCm38)	missense	probably benign	0.00
IGL02492:Atm	APN	9	53,455,859 (GRCm38)	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53,497,262 (GRCm38)	splice site	probably benign
IGL02633:Atm	APN	9	53,448,153 (GRCm38)	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53,516,563 (GRCm38)	missense	probably benign	0.00
IGL02948:Atm	APN	9	53,453,440 (GRCm38)	splice site	probably benign
IGL02959:Atm	APN	9	53,471,418 (GRCm38)	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53,453,563 (GRCm38)	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53,484,171 (GRCm38)	missense	possibly damaging	0.89
antebellum	UTSW	9	53,518,559 (GRCm38)	nonsense	probably null
bull_run	UTSW	9	53,487,922 (GRCm38)	missense	probably benign	0.09
Civil	UTSW	9	53,492,268 (GRCm38)	missense	possibly damaging	0.78
gettysburg	UTSW	9	53,455,988 (GRCm38)	splice site	probably null
Grant	UTSW	9	53,511,917 (GRCm38)	nonsense	probably null
Indicative	UTSW	9	53,445,376 (GRCm38)	splice site	probably null
Marker	UTSW	9	53,454,279 (GRCm38)	splice site	probably benign
maunder	UTSW	9	53,499,197 (GRCm38)	nonsense	probably null
mockingbird	UTSW	9	53,516,467 (GRCm38)	nonsense	probably null
mockingbird2	UTSW	9	53,488,587 (GRCm38)	missense	probably damaging	1.00
osphere	UTSW	9	53,479,673 (GRCm38)	missense	probably damaging	0.99
shiloh	UTSW	9	53,465,298 (GRCm38)	missense	probably damaging	1.00
Strato	UTSW	9	53,503,018 (GRCm38)	missense	probably damaging	1.00
thrasher	UTSW	9	53,445,507 (GRCm38)	missense	probably benign	0.01
Tropo	UTSW	9	53,531,648 (GRCm38)	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53,465,028 (GRCm38)	splice site	probably benign
PIT4403001:Atm	UTSW	9	53,500,982 (GRCm38)	missense	probably benign
PIT4687001:Atm	UTSW	9	53,486,812 (GRCm38)	critical splice donor site	probably null
R0004:Atm	UTSW	9	53,453,528 (GRCm38)	splice site	probably benign
R0035:Atm	UTSW	9	53,513,180 (GRCm38)	missense	probably benign	0.01
R0098:Atm	UTSW	9	53,518,569 (GRCm38)	missense	probably benign	0.10
R0098:Atm	UTSW	9	53,518,569 (GRCm38)	missense	probably benign	0.10
R0201:Atm	UTSW	9	53,454,279 (GRCm38)	splice site	probably benign
R0304:Atm	UTSW	9	53,516,344 (GRCm38)	missense	probably benign	0.34
R0308:Atm	UTSW	9	53,454,473 (GRCm38)	splice site	probably null
R0362:Atm	UTSW	9	53,458,838 (GRCm38)	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53,460,966 (GRCm38)	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53,503,948 (GRCm38)	missense	probably benign	0.00
R0589:Atm	UTSW	9	53,490,192 (GRCm38)	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53,458,941 (GRCm38)	nonsense	probably null
R0630:Atm	UTSW	9	53,531,622 (GRCm38)	splice site	probably benign
R0652:Atm	UTSW	9	53,486,014 (GRCm38)	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53,515,239 (GRCm38)	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53,456,566 (GRCm38)	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53,459,823 (GRCm38)	missense	probably benign
R0947:Atm	UTSW	9	53,504,092 (GRCm38)	missense	probably benign	0.01
R0948:Atm	UTSW	9	53,495,958 (GRCm38)	missense	probably benign
R1144:Atm	UTSW	9	53,511,698 (GRCm38)	splice site	probably benign
R1252:Atm	UTSW	9	53,455,840 (GRCm38)	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53,456,530 (GRCm38)	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53,456,530 (GRCm38)	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53,457,489 (GRCm38)	missense	probably benign	0.00
R1477:Atm	UTSW	9	53,464,273 (GRCm38)	missense	probably benign	0.00
R1596:Atm	UTSW	9	53,453,378 (GRCm38)	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53,479,673 (GRCm38)	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53,500,932 (GRCm38)	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53,522,155 (GRCm38)	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53,500,700 (GRCm38)	missense	probably benign
R1817:Atm	UTSW	9	53,492,233 (GRCm38)	splice site	probably benign
R1840:Atm	UTSW	9	53,456,530 (GRCm38)	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53,468,012 (GRCm38)	missense	probably benign	0.06
R1906:Atm	UTSW	9	53,506,568 (GRCm38)	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53,471,418 (GRCm38)	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53,443,997 (GRCm38)	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53,500,969 (GRCm38)	missense	probably benign	0.36
R2134:Atm	UTSW	9	53,467,964 (GRCm38)	critical splice donor site	probably null
R2137:Atm	UTSW	9	53,453,375 (GRCm38)	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53,490,909 (GRCm38)	splice site	probably null
R2348:Atm	UTSW	9	53,492,268 (GRCm38)	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53,510,266 (GRCm38)	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53,457,470 (GRCm38)	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53,507,805 (GRCm38)	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53,494,711 (GRCm38)	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53,480,750 (GRCm38)	missense	probably benign	0.00
R3236:Atm	UTSW	9	53,479,748 (GRCm38)	missense	probably benign	0.15
R3847:Atm	UTSW	9	53,503,075 (GRCm38)	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53,506,636 (GRCm38)	splice site	probably benign
R3919:Atm	UTSW	9	53,492,278 (GRCm38)	missense	probably benign	0.00
R4125:Atm	UTSW	9	53,450,621 (GRCm38)	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53,480,669 (GRCm38)	missense	probably benign
R4395:Atm	UTSW	9	53,465,227 (GRCm38)	missense	probably benign	0.09
R4502:Atm	UTSW	9	53,495,946 (GRCm38)	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53,493,039 (GRCm38)	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53,500,759 (GRCm38)	missense	probably benign	0.39
R4593:Atm	UTSW	9	53,453,594 (GRCm38)	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53,456,506 (GRCm38)	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53,531,733 (GRCm38)	missense	probably benign	0.01
R4665:Atm	UTSW	9	53,464,229 (GRCm38)	missense	probably benign	0.00
R4672:Atm	UTSW	9	53,522,201 (GRCm38)	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53,453,607 (GRCm38)	missense	probably benign	0.10
R4808:Atm	UTSW	9	53,445,495 (GRCm38)	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53,515,301 (GRCm38)	missense	probably benign
R4996:Atm	UTSW	9	53,524,507 (GRCm38)	missense	probably benign	0.09
R5030:Atm	UTSW	9	53,520,109 (GRCm38)	nonsense	probably null
R5214:Atm	UTSW	9	53,491,027 (GRCm38)	missense	probably benign	0.09
R5260:Atm	UTSW	9	53,506,611 (GRCm38)	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53,518,623 (GRCm38)	missense	probably benign	0.00
R5394:Atm	UTSW	9	53,507,777 (GRCm38)	critical splice donor site	probably null
R5400:Atm	UTSW	9	53,503,018 (GRCm38)	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53,459,804 (GRCm38)	missense	probably benign	0.00
R5441:Atm	UTSW	9	53,516,467 (GRCm38)	nonsense	probably null
R5569:Atm	UTSW	9	53,516,450 (GRCm38)	nonsense	probably null
R5856:Atm	UTSW	9	53,495,955 (GRCm38)	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53,497,159 (GRCm38)	missense	probably benign
R5910:Atm	UTSW	9	53,448,080 (GRCm38)	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53,459,873 (GRCm38)	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53,488,587 (GRCm38)	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53,524,414 (GRCm38)	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53,524,509 (GRCm38)	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53,490,959 (GRCm38)	missense	probably benign	0.04
R6267:Atm	UTSW	9	53,444,000 (GRCm38)	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53,487,922 (GRCm38)	missense	probably benign	0.09
R6284:Atm	UTSW	9	53,445,376 (GRCm38)	splice site	probably null
R6478:Atm	UTSW	9	53,490,254 (GRCm38)	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53,440,157 (GRCm38)	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53,493,177 (GRCm38)	missense	probably benign	0.00
R6704:Atm	UTSW	9	53,458,853 (GRCm38)	missense	probably benign	0.02
R6715:Atm	UTSW	9	53,531,648 (GRCm38)	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53,486,051 (GRCm38)	missense	probably benign	0.30
R6759:Atm	UTSW	9	53,518,559 (GRCm38)	nonsense	probably null
R6766:Atm	UTSW	9	53,490,282 (GRCm38)	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53,497,235 (GRCm38)	missense	probably benign	0.00
R6852:Atm	UTSW	9	53,482,430 (GRCm38)	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53,507,881 (GRCm38)	missense	probably benign	0.02
R7208:Atm	UTSW	9	53,512,008 (GRCm38)	splice site	probably null
R7211:Atm	UTSW	9	53,488,560 (GRCm38)	missense	probably benign	0.01
R7220:Atm	UTSW	9	53,511,917 (GRCm38)	nonsense	probably null
R7336:Atm	UTSW	9	53,462,503 (GRCm38)	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53,465,298 (GRCm38)	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53,453,437 (GRCm38)	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53,448,125 (GRCm38)	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53,524,354 (GRCm38)	missense	probably benign
R7497:Atm	UTSW	9	53,511,891 (GRCm38)	missense	probably benign	0.00
R7584:Atm	UTSW	9	53,513,127 (GRCm38)	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53,454,768 (GRCm38)	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53,490,302 (GRCm38)	nonsense	probably null
R7660:Atm	UTSW	9	53,445,507 (GRCm38)	missense	probably benign	0.01
R7679:Atm	UTSW	9	53,442,497 (GRCm38)	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53,522,239 (GRCm38)	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53,455,988 (GRCm38)	splice site	probably null
R8247:Atm	UTSW	9	53,450,570 (GRCm38)	missense
R8334:Atm	UTSW	9	53,522,273 (GRCm38)	missense	probably benign	0.00
R8503:Atm	UTSW	9	53,488,052 (GRCm38)	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53,524,497 (GRCm38)	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53,499,197 (GRCm38)	nonsense	probably null
R8838:Atm	UTSW	9	53,516,551 (GRCm38)	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53,458,834 (GRCm38)	missense	probably benign	0.01
R9131:Atm	UTSW	9	53,533,744 (GRCm38)	missense	probably benign	0.10
R9191:Atm	UTSW	9	53,527,290 (GRCm38)	missense	probably benign	0.29
R9257:Atm	UTSW	9	53,495,850 (GRCm38)	critical splice donor site	probably null
R9473:Atm	UTSW	9	53,498,972 (GRCm38)	missense	probably benign
R9558:Atm	UTSW	9	53,500,781 (GRCm38)	missense	probably benign	0.00
R9598:Atm	UTSW	9	53,520,081 (GRCm38)	missense	probably benign	0.34
R9717:Atm	UTSW	9	53,516,517 (GRCm38)	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53,518,567 (GRCm38)	missense	probably benign
X0067:Atm	UTSW	9	53,479,694 (GRCm38)	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53,531,687 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTATCGTCAACAATCACCTCATGAG -3'
(R):5'- CCCAAGACATCCTCAGTCAGTG -3'

Sequencing Primer
(F):5'- GACTGAAGAACCTTCCGA -3'
(R):5'- GACATCCTCAGTCAGTGCTAAAAAC -3'

Posted On

2015-07-21