Incidental Mutation 'R4466:Ten1'
ID330361
Institutional Source Beutler Lab
Gene Symbol Ten1
Ensembl Gene ENSMUSG00000020778
Gene NameTEN1 telomerase capping complex subunit
Synonyms
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4466 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116198855-116215318 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 116204997 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021130]
Predicted Effect probably benign
Transcript: ENSMUST00000021130
SMART Domains Protein: ENSMUSP00000021130
Gene: ENSMUSG00000020778

DomainStartEndE-ValueType
Pfam:Ten1_2 2 118 1.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146066
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C17ORF106, or TEN1, appears to function in a telomere-associated complex with STN1 (OBFC1; MIM 613128) and CTC1 (C17ORF68; MIM 613129) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Sox8 C A 17: 25,568,905 G190V probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Ten1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0762:Ten1 UTSW 11 116216684 splice site probably benign
R3051:Ten1 UTSW 11 116205730 missense possibly damaging 0.71
R3977:Ten1 UTSW 11 116216945 unclassified probably null
R4863:Ten1 UTSW 11 116218231 missense probably benign 0.02
R4931:Ten1 UTSW 11 116205729 missense probably benign 0.32
R5870:Ten1 UTSW 11 116214925 missense possibly damaging 0.71
R7590:Ten1 UTSW 11 116205640 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGGAAATCTCTCAAGACTTGTG -3'
(R):5'- TAAACCCCAGATGCTCCTGC -3'

Sequencing Primer
(F):5'- AAATCTCTCAAGACTTGTGGTTGGC -3'
(R):5'- TTCCAAACGGGGACAGC -3'
Posted On2015-07-21