Incidental Mutation 'R4466:Sox8'
ID330369
Institutional Source Beutler Lab
Gene Symbol Sox8
Ensembl Gene ENSMUSG00000024176
Gene NameSRY (sex determining region Y)-box 8
Synonyms
MMRRC Submission 041723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4466 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25565892-25570686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25568905 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 190 (G190V)
Ref Sequence ENSEMBL: ENSMUSP00000025003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]
Predicted Effect probably benign
Transcript: ENSMUST00000025003
AA Change: G190V

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: G190V

DomainStartEndE-ValueType
Pfam:Sox_N 18 86 3.8e-27 PFAM
HMG 98 168 3.86e-28 SMART
low complexity region 208 228 N/A INTRINSIC
low complexity region 303 321 N/A INTRINSIC
low complexity region 375 397 N/A INTRINSIC
low complexity region 407 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Predicted Effect probably benign
Transcript: ENSMUST00000173447
AA Change: G190V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176
AA Change: G190V

DomainStartEndE-ValueType
Pfam:Sox_N 3 87 3.3e-25 PFAM
HMG 98 168 3.86e-28 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174560
AA Change: G87V
SMART Domains Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176
AA Change: G87V

DomainStartEndE-ValueType
HMG 1 66 1.19e-19 SMART
Meta Mutation Damage Score 0.0682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A T 3: 59,838,466 noncoding transcript Het
Adgra1 T A 7: 139,840,836 probably benign Het
Akap13 T A 7: 75,602,773 probably null Het
Amn1 T C 6: 149,166,845 probably null Het
Ano5 T A 7: 51,570,275 F374I probably damaging Het
Apol7c T C 15: 77,526,464 E94G probably benign Het
Arid4b A T 13: 14,132,510 S117C probably damaging Het
Atm C A 9: 53,448,169 E2778* probably null Het
Cped1 A T 6: 22,123,652 Q468L probably benign Het
Crygb A G 1: 65,080,486 S112P probably damaging Het
Eml4 C T 17: 83,421,674 Q93* probably null Het
Eps15 G A 4: 109,366,530 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam102b T A 3: 108,979,808 R291S probably benign Het
Fhad1 A T 4: 141,957,658 S457T probably damaging Het
Frmd4b A G 6: 97,323,653 probably null Het
Gm5134 G C 10: 76,008,575 K588N probably benign Het
Gpr21 A G 2: 37,517,558 T39A probably benign Het
Irx1 C A 13: 71,959,982 G194W probably damaging Het
Itgal C T 7: 127,328,512 T992I possibly damaging Het
Itpr3 T C 17: 27,106,342 L1303P probably damaging Het
Kdm2a A T 19: 4,320,300 D1052E probably damaging Het
Klhl6 T C 16: 19,957,268 D180G probably damaging Het
M6pr A G 6: 122,313,269 T64A probably benign Het
Mrpl47 G A 3: 32,730,091 R177* probably null Het
Mtfr2 A G 10: 20,348,413 Y31C probably damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Oas2 A G 5: 120,749,602 S58P probably damaging Het
Olfr1489 G A 19: 13,633,437 E109K probably damaging Het
Olfr339 A T 2: 36,422,296 R299S probably benign Het
Olfr883 T A 9: 38,026,183 C126S probably damaging Het
Polr1b A T 2: 129,123,882 I815L probably benign Het
Psma8 T C 18: 14,721,174 I37T possibly damaging Het
Ryr3 T C 2: 112,653,102 E4100G possibly damaging Het
Serpina3g C T 12: 104,237,923 probably benign Het
Serpina3m A T 12: 104,391,615 Y266F probably damaging Het
Sez6l2 T A 7: 126,959,851 D423E probably damaging Het
Sh3gl2 A G 4: 85,381,451 E224G possibly damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc24a2 A T 4: 87,227,862 probably benign Het
Smyd2 A G 1: 189,882,152 M393T probably benign Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stk35 C A 2: 129,801,516 T140K probably damaging Het
Taf6 A C 5: 138,181,201 probably benign Het
Ten1 A C 11: 116,204,997 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttn A G 2: 76,713,700 F32981L probably damaging Het
Zik1 G T 7: 10,490,966 T68K probably benign Het
Zzef1 T A 11: 72,924,659 I2935N probably damaging Het
Other mutations in Sox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Sox8 APN 17 25567528 unclassified probably null
IGL01918:Sox8 APN 17 25570137 missense probably damaging 1.00
IGL02672:Sox8 APN 17 25568989 missense probably damaging 1.00
IGL03371:Sox8 APN 17 25567440 missense probably damaging 1.00
R1398:Sox8 UTSW 17 25567883 missense probably benign 0.01
R1673:Sox8 UTSW 17 25567482 missense possibly damaging 0.77
R1742:Sox8 UTSW 17 25567941 missense probably damaging 0.99
R4019:Sox8 UTSW 17 25570297 missense probably damaging 1.00
R4353:Sox8 UTSW 17 25567335 makesense probably null
R4893:Sox8 UTSW 17 25568989 missense probably damaging 1.00
R4929:Sox8 UTSW 17 25570356 missense probably benign 0.21
R5915:Sox8 UTSW 17 25567469 missense probably damaging 1.00
R6114:Sox8 UTSW 17 25567520 missense probably damaging 1.00
R6915:Sox8 UTSW 17 25567914 missense probably damaging 1.00
R7030:Sox8 UTSW 17 25570108 critical splice donor site probably null
R7232:Sox8 UTSW 17 25567540 missense probably benign 0.01
R7549:Sox8 UTSW 17 25567961 missense probably damaging 0.99
Z1177:Sox8 UTSW 17 25567743 missense probably benign 0.00
Z1177:Sox8 UTSW 17 25568984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTAGATGGAGCTAGGC -3'
(R):5'- TAGGTCCTTGGCAAGTCTGGAG -3'

Sequencing Primer
(F):5'- TTTTTACAAGGGATCGGGGAAGACC -3'
(R):5'- TTGGCAAGTCTGGAGCTCCG -3'
Posted On2015-07-21