Incidental Mutation 'R4472:Phlpp1'
ID330381
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4472 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106386446 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1183 (D1183G)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: D1183G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: D1183G

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Meta Mutation Damage Score 0.4498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrb2 C T 4: 130,008,353 A509V probably benign Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Atg2a G A 19: 6,258,955 V1724M probably damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Cntn5 A T 9: 10,048,771 D262E probably damaging Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Mrgpra4 T C 7: 47,981,791 T21A probably benign Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nkain4 C G 2: 180,954,622 M1I probably null Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAGTCCAGGCTCTGTTCAC -3'
(R):5'- ATCACAAGGCACCAGCTTTTC -3'

Sequencing Primer
(F):5'- GTTCACCCAACCTCCTGGAG -3'
(R):5'- GGCACCAGCTTTTCTAGTAAGAG -3'
Posted On2015-07-21