Incidental Mutation 'R4472:Nkain4'
ID330394
Institutional Source Beutler Lab
Gene Symbol Nkain4
Ensembl Gene ENSMUSG00000027574
Gene NameNa+/K+ transporting ATPase interacting 4
Synonyms
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4472 (G1)
Quality Score212
Status Validated
Chromosome2
Chromosomal Location180934772-180954699 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to G at 180954622 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000119925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103053] [ENSMUST00000108873] [ENSMUST00000148905]
Predicted Effect probably null
Transcript: ENSMUST00000103053
AA Change: M1I

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099342
Gene: ENSMUSG00000027574
AA Change: M1I

DomainStartEndE-ValueType
Pfam:NKAIN 1 206 4.3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108873
AA Change: M1I

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104501
Gene: ENSMUSG00000027574
AA Change: M1I

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 2.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134231
Predicted Effect probably benign
Transcript: ENSMUST00000139929
SMART Domains Protein: ENSMUSP00000116965
Gene: ENSMUSG00000027574

DomainStartEndE-ValueType
Pfam:NKAIN 15 144 2.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148905
AA Change: M1I

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119925
Gene: ENSMUSG00000027574
AA Change: M1I

DomainStartEndE-ValueType
Pfam:NKAIN 1 66 1.4e-36 PFAM
Pfam:NKAIN 64 140 8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154616
Meta Mutation Damage Score 0.8794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN4 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain and interacts with the beta subunit of Na,K-ATPase (ATP1B1; MIM 182330) (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrb2 C T 4: 130,008,353 A509V probably benign Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Atg2a G A 19: 6,258,955 V1724M probably damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Cntn5 A T 9: 10,048,771 D262E probably damaging Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Mrgpra4 T C 7: 47,981,791 T21A probably benign Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Phlpp1 A G 1: 106,386,446 D1183G probably damaging Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Nkain4
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Nkain4 UTSW 2 180943145 missense probably benign 0.01
IGL02799:Nkain4 UTSW 2 180935935 unclassified probably null
R0648:Nkain4 UTSW 2 180943112 missense possibly damaging 0.91
R1619:Nkain4 UTSW 2 180936001 missense probably damaging 0.98
R5666:Nkain4 UTSW 2 180943202 missense probably damaging 0.99
R5670:Nkain4 UTSW 2 180943202 missense probably damaging 0.99
R6191:Nkain4 UTSW 2 180936003 missense probably damaging 1.00
R6191:Nkain4 UTSW 2 180936004 missense probably damaging 1.00
R6713:Nkain4 UTSW 2 180944177 missense probably damaging 1.00
R7228:Nkain4 UTSW 2 180954569 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGAAGGCTTTTGTTCCTAGCTG -3'
(R):5'- TTTACCCGAGGCAAGATCCC -3'

Sequencing Primer
(F):5'- AGGGACGCTACTCCCCAAG -3'
(R):5'- AGGCAAGATCCCGTTGGG -3'
Posted On2015-07-21