Incidental Mutation 'R4472:Mrgpra4'
ID330411
Institutional Source Beutler Lab
Gene Symbol Mrgpra4
Ensembl Gene ENSMUSG00000067173
Gene NameMAS-related GPR, member A4
SynonymsMrgA4
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4472 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47980837-47982095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47981791 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000084327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087092]
Predicted Effect probably benign
Transcript: ENSMUST00000087092
AA Change: T21A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084327
Gene: ENSMUSG00000067173
AA Change: T21A

DomainStartEndE-ValueType
Pfam:7tm_1 38 270 1.3e-10 PFAM
Meta Mutation Damage Score 0.1245 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrb2 C T 4: 130,008,353 A509V probably benign Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Atg2a G A 19: 6,258,955 V1724M probably damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Cntn5 A T 9: 10,048,771 D262E probably damaging Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nkain4 C G 2: 180,954,622 M1I probably null Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Phlpp1 A G 1: 106,386,446 D1183G probably damaging Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Mrgpra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Mrgpra4 APN 7 47981304 missense possibly damaging 0.54
IGL02083:Mrgpra4 APN 7 47981060 nonsense probably null
IGL02155:Mrgpra4 APN 7 47981544 missense probably damaging 0.99
IGL02577:Mrgpra4 APN 7 47981233 missense probably benign 0.10
IGL02674:Mrgpra4 APN 7 47980942 missense probably benign 0.09
IGL02696:Mrgpra4 APN 7 47981503 missense possibly damaging 0.96
R0357:Mrgpra4 UTSW 7 47981826 missense probably benign
R0543:Mrgpra4 UTSW 7 47981310 missense probably benign 0.00
R0677:Mrgpra4 UTSW 7 47980980 missense probably benign 0.00
R1163:Mrgpra4 UTSW 7 47981476 missense probably damaging 1.00
R1217:Mrgpra4 UTSW 7 47981337 missense probably benign 0.00
R2255:Mrgpra4 UTSW 7 47981775 missense possibly damaging 0.70
R4191:Mrgpra4 UTSW 7 47981119 missense probably benign 0.00
R4303:Mrgpra4 UTSW 7 47980936 missense probably benign 0.02
R4757:Mrgpra4 UTSW 7 47980938 missense probably damaging 1.00
R4976:Mrgpra4 UTSW 7 47981718 missense probably damaging 1.00
R5004:Mrgpra4 UTSW 7 47981787 missense probably benign 0.26
R5034:Mrgpra4 UTSW 7 47981569 missense probably benign 0.00
R5119:Mrgpra4 UTSW 7 47981718 missense probably damaging 1.00
R5722:Mrgpra4 UTSW 7 47981007 missense probably benign
R6800:Mrgpra4 UTSW 7 47981623 missense probably damaging 1.00
R7163:Mrgpra4 UTSW 7 47981490 missense probably benign 0.42
R7585:Mrgpra4 UTSW 7 47981629 missense probably benign 0.24
R7636:Mrgpra4 UTSW 7 47980973 missense possibly damaging 0.95
X0028:Mrgpra4 UTSW 7 47981420 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCTTGAGAAGAAGCATTGTG -3'
(R):5'- TTGATGCCCCAGTGTAAGG -3'

Sequencing Primer
(F):5'- AGCATTGTGGAATTTATGATGTGAC -3'
(R):5'- TGTGGGTTGAGCAACACC -3'
Posted On2015-07-21