Incidental Mutation 'R4472:Cntn5'
ID330415
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4472 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10048771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 262 (D262E)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably damaging
Transcript: ENSMUST00000074133
AA Change: D262E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: D262E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160216
AA Change: D262E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: D262E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162484
AA Change: D57E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: D57E

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179049
AA Change: D57E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: D57E

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Meta Mutation Damage Score 0.5370 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrb2 C T 4: 130,008,353 A509V probably benign Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Atg2a G A 19: 6,258,955 V1724M probably damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Mrgpra4 T C 7: 47,981,791 T21A probably benign Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nkain4 C G 2: 180,954,622 M1I probably null Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Phlpp1 A G 1: 106,386,446 D1183G probably damaging Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8117:Cntn5 UTSW 9 9673950 missense probably benign 0.33
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCGGCATACACAAACTC -3'
(R):5'- GCTTTGTCTGCCAGTTAAATGATC -3'

Sequencing Primer
(F):5'- CATTTGTGAGTAGGGCAGATGC -3'
(R):5'- GGTCTTCAATGAGTTCCC -3'
Posted On2015-07-21