Mutagenetix > Incidental Mutation

Incidental Mutation 'R4472:Trim27'

330426

Institutional Source

Beutler Lab

Gene Symbol

Trim27

Ensembl Gene

ENSMUSG00000021326

Gene Name

tripartite motif-containing 27

Synonyms

Rfp

MMRRC Submission

041729-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.369) question?

Stock #

R4472 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21363615-21378894 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21374056 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 268 (I268V)

Ref Sequence

ENSEMBL: ENSMUSP00000152179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021761] [ENSMUST00000221464] [ENSMUST00000222544] [ENSMUST00000223065]

AlphaFold

Q62158

Predicted Effect

probably benign
Transcript: ENSMUST00000021761
AA Change: I268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021761
Gene: ENSMUSG00000021326
AA Change: I268V

Domain	Start	End	E-Value	Type
RING	16	56	2.53e-6	SMART
BBOX	91	132	4.71e-15	SMART
low complexity region	146	170	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC
PRY	315	367	7.09e-28	SMART
SPRY	368	493	1e-42	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124794

Predicted Effect

unknown
Transcript: ENSMUST00000139287
AA Change: I11V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220690

Predicted Effect

probably benign
Transcript: ENSMUST00000221464
AA Change: I92V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000222544
AA Change: I268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000223065
AA Change: I268V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit exhibit increased potassium/calcium channel activity and TCR-stimulated calcium influx in Th1 and Th2 CD4 T cells. Mice homozygous for another gene trap allele exhibit decreased incidence of chemically-induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J11Rik	A	T	9: 39,961,994 (GRCm39)		noncoding transcript	Het
Accsl	T	A	2: 93,694,336 (GRCm39)		probably null	Het
Accsl	G	T	2: 93,694,337 (GRCm39)		probably null	Het
Adcy1	G	A	11: 7,080,369 (GRCm39)	V371M	probably damaging	Het
Adgrb2	C	T	4: 129,902,146 (GRCm39)	A509V	probably benign	Het
Adgrg6	T	A	10: 14,312,525 (GRCm39)	Q754L	probably damaging	Het
Agap2	T	C	10: 126,927,082 (GRCm39)	I1008T	probably damaging	Het
Aph1c	T	G	9: 66,735,051 (GRCm39)	H150P	probably damaging	Het
Atcay	T	C	10: 81,048,361 (GRCm39)	R242G	possibly damaging	Het
Atg2a	G	A	19: 6,308,985 (GRCm39)	V1724M	probably damaging	Het
Bbs12	T	C	3: 37,373,369 (GRCm39)	V54A	possibly damaging	Het
Card14	A	G	11: 119,224,784 (GRCm39)	M604V	possibly damaging	Het
Cd28	A	T	1: 60,802,393 (GRCm39)	H104L	probably benign	Het
Cntn5	A	T	9: 10,048,776 (GRCm39)	D262E	probably damaging	Het
Col6a3	A	G	1: 90,749,736 (GRCm39)	V366A	probably benign	Het
Csnk1d	G	A	11: 120,855,800 (GRCm39)		probably benign	Het
Dcaf11	T	A	14: 55,803,063 (GRCm39)		probably benign	Het
Dpy19l4	G	A	4: 11,304,053 (GRCm39)	T119M	possibly damaging	Het
Eif3f	T	C	7: 108,540,153 (GRCm39)	V316A	possibly damaging	Het
Fbrsl1	G	A	5: 110,526,932 (GRCm39)		probably benign	Het
Fbxo10	C	T	4: 45,043,693 (GRCm39)	R710H	probably damaging	Het
Fbxw9	G	A	8: 85,786,829 (GRCm39)	D25N	probably damaging	Het
Gm14295	C	T	2: 176,501,386 (GRCm39)	T292I	possibly damaging	Het
Gm4884	C	G	7: 40,692,687 (GRCm39)	Q219E	probably benign	Het
Gpr150	A	G	13: 76,204,273 (GRCm39)	V224A	probably benign	Het
Hps1	A	T	19: 42,750,935 (GRCm39)	I355N	probably damaging	Het
Lmbr1l	A	G	15: 98,804,178 (GRCm39)	S374P	probably benign	Het
Macf1	A	T	4: 123,289,782 (GRCm39)	N5458K	probably damaging	Het
Man1b1	C	G	2: 25,222,867 (GRCm39)		probably benign	Het
Morc3	A	G	16: 93,671,645 (GRCm39)		probably null	Het
Mrgpra4	T	C	7: 47,631,539 (GRCm39)	T21A	probably benign	Het
Myo1a	G	T	10: 127,546,327 (GRCm39)	V277L	probably benign	Het
Nkain4	C	G	2: 180,596,415 (GRCm39)	M1I	probably null	Het
Nktr	T	C	9: 121,577,962 (GRCm39)		probably benign	Het
Nrxn3	T	C	12: 90,171,515 (GRCm39)	S276P	probably damaging	Het
Oas2	A	T	5: 120,879,220 (GRCm39)	D373E	possibly damaging	Het
Or8g37	T	A	9: 39,731,870 (GRCm39)	*312R	probably null	Het
Oser1	T	A	2: 163,257,500 (GRCm39)	E11V	probably null	Het
Oser1	C	T	2: 163,257,501 (GRCm39)	E11K	probably damaging	Het
Pacsin3	A	G	2: 91,093,288 (GRCm39)		probably null	Het
Pcdh20	T	C	14: 88,706,434 (GRCm39)	S289G	probably benign	Het
Phlpp1	A	G	1: 106,314,176 (GRCm39)	D1183G	probably damaging	Het
Pign	T	C	1: 105,575,945 (GRCm39)	K232E	probably benign	Het
Polk	A	G	13: 96,630,413 (GRCm39)	S383P	probably damaging	Het
Prom2	C	A	2: 127,382,111 (GRCm39)	R101L	probably benign	Het
Rest	T	C	5: 77,429,027 (GRCm39)	V482A	probably benign	Het
Rexo1	A	T	10: 80,378,492 (GRCm39)	S476T	probably damaging	Het
Rnf31	T	A	14: 55,840,777 (GRCm39)	Y1015N	probably damaging	Het
Spata3	T	C	1: 85,954,152 (GRCm39)	Y305H	probably benign	Het
Sv2a	G	A	3: 96,099,810 (GRCm39)	V587M	probably benign	Het
Synj1	A	G	16: 90,766,069 (GRCm39)		probably null	Het
Syt17	A	G	7: 118,036,040 (GRCm39)		probably null	Het
Taf2	T	C	15: 54,922,276 (GRCm39)	D337G	possibly damaging	Het
Tcaf1	A	C	6: 42,656,248 (GRCm39)	S243A	probably benign	Het
Tmem9	A	G	1: 135,955,234 (GRCm39)	T123A	probably benign	Het
Trav4-4-dv10	T	C	14: 53,921,187 (GRCm39)		probably benign	Het
Trbv15	G	A	6: 41,118,493 (GRCm39)	R83Q	probably damaging	Het
Tubgcp6	T	A	15: 88,987,857 (GRCm39)	S1031C	probably damaging	Het
Vmn1r89	C	A	7: 12,953,799 (GRCm39)	H110Q	probably benign	Het
Vmn2r30	T	C	7: 7,320,091 (GRCm39)	N545S	probably damaging	Het
Wls	G	A	3: 159,603,020 (GRCm39)	M144I	probably benign	Het
Yme1l1	T	C	2: 23,076,344 (GRCm39)		probably null	Het
Zeb2	A	T	2: 44,913,023 (GRCm39)	L56Q	probably damaging	Het

Other mutations in Trim27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01865:Trim27	APN	13	21,376,662 (GRCm39)	missense	probably damaging	0.98
IGL02756:Trim27	APN	13	21,374,256 (GRCm39)	splice site	probably benign
IGL03199:Trim27	APN	13	21,375,421 (GRCm39)	splice site	probably null
R0016:Trim27	UTSW	13	21,375,399 (GRCm39)	missense	probably benign	0.14
R0016:Trim27	UTSW	13	21,375,399 (GRCm39)	missense	probably benign	0.14
R1709:Trim27	UTSW	13	21,372,235 (GRCm39)	critical splice donor site	probably null
R2188:Trim27	UTSW	13	21,367,987 (GRCm39)	missense	probably damaging	1.00
R4657:Trim27	UTSW	13	21,367,930 (GRCm39)	missense	probably damaging	1.00
R4677:Trim27	UTSW	13	21,365,086 (GRCm39)	critical splice donor site	probably null
R5019:Trim27	UTSW	13	21,374,134 (GRCm39)	missense	probably damaging	1.00
R5584:Trim27	UTSW	13	21,376,719 (GRCm39)	missense	probably damaging	1.00
R6226:Trim27	UTSW	13	21,365,086 (GRCm39)	critical splice donor site	probably benign
R6774:Trim27	UTSW	13	21,376,624 (GRCm39)	missense	probably damaging	1.00
R7378:Trim27	UTSW	13	21,376,631 (GRCm39)	missense	possibly damaging	0.92
R7573:Trim27	UTSW	13	21,364,770 (GRCm39)	missense	probably damaging	0.96
R7662:Trim27	UTSW	13	21,376,328 (GRCm39)	missense	probably benign	0.05
R8272:Trim27	UTSW	13	21,364,780 (GRCm39)	missense	probably benign	0.14
R8723:Trim27	UTSW	13	21,374,807 (GRCm39)	intron	probably benign
R8914:Trim27	UTSW	13	21,364,993 (GRCm39)	missense	possibly damaging	0.77
R9380:Trim27	UTSW	13	21,364,680 (GRCm39)	missense	probably benign	0.00
R9717:Trim27	UTSW	13	21,374,296 (GRCm39)	critical splice donor site	probably null
X0062:Trim27	UTSW	13	21,368,044 (GRCm39)	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TAAAGTTTGTGGTAGCGAGCTC -3'
(R):5'- CCTGGACTGTCTATATACTCGC -3'

Sequencing Primer
(F):5'- GAGCTCTAAAGACTGCCTACTTGTG -3'
(R):5'- ATACTCGCTTCTTTCCAAGAAAC -3'

Posted On

2015-07-21