Mutagenetix > Incidental Mutation

Incidental Mutation 'R4472:Taf2'

330433

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

041729-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4472 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55058880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 337 (D337G)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041733
AA Change: D337G

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: D337G

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Meta Mutation Damage Score

0.9395

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J11Rik	A	T	9: 40,050,698		noncoding transcript	Het
Accsl	T	A	2: 93,863,991		probably null	Het
Accsl	G	T	2: 93,863,992		probably null	Het
Adcy1	G	A	11: 7,130,369	V371M	probably damaging	Het
Adgrb2	C	T	4: 130,008,353	A509V	probably benign	Het
Adgrg6	T	A	10: 14,436,781	Q754L	probably damaging	Het
Agap2	T	C	10: 127,091,213	I1008T	probably damaging	Het
Aph1c	T	G	9: 66,827,769	H150P	probably damaging	Het
Atcay	T	C	10: 81,212,527	R242G	possibly damaging	Het
Atg2a	G	A	19: 6,258,955	V1724M	probably damaging	Het
Bbs12	T	C	3: 37,319,220	V54A	possibly damaging	Het
Card14	A	G	11: 119,333,958	M604V	possibly damaging	Het
Cd28	A	T	1: 60,763,234	H104L	probably benign	Het
Cntn5	A	T	9: 10,048,771	D262E	probably damaging	Het
Col6a3	A	G	1: 90,822,014	V366A	probably benign	Het
Csnk1d	G	A	11: 120,964,974		probably benign	Het
Dcaf11	T	A	14: 55,565,606		probably benign	Het
Dpy19l4	G	A	4: 11,304,053	T119M	possibly damaging	Het
Eif3f	T	C	7: 108,940,946	V316A	possibly damaging	Het
Fbrsl1	G	A	5: 110,379,066		probably benign	Het
Fbxo10	C	T	4: 45,043,693	R710H	probably damaging	Het
Fbxw9	G	A	8: 85,060,200	D25N	probably damaging	Het
Gm14295	C	T	2: 176,809,593	T292I	possibly damaging	Het
Gm4884	C	G	7: 41,043,263	Q219E	probably benign	Het
Gpr150	A	G	13: 76,056,154	V224A	probably benign	Het
Hps1	A	T	19: 42,762,496	I355N	probably damaging	Het
Lmbr1l	A	G	15: 98,906,297	S374P	probably benign	Het
Macf1	A	T	4: 123,395,989	N5458K	probably damaging	Het
Man1b1	C	G	2: 25,332,855		probably benign	Het
Morc3	A	G	16: 93,874,757		probably null	Het
Mrgpra4	T	C	7: 47,981,791	T21A	probably benign	Het
Myo1a	G	T	10: 127,710,458	V277L	probably benign	Het
Nkain4	C	G	2: 180,954,622	M1I	probably null	Het
Nktr	T	C	9: 121,748,896		probably benign	Het
Nrxn3	T	C	12: 90,204,741	S276P	probably damaging	Het
Oas2	A	T	5: 120,741,155	D373E	possibly damaging	Het
Olfr970	T	A	9: 39,820,574	*312R	probably null	Het
Oser1	T	A	2: 163,415,580	E11V	probably null	Het
Oser1	C	T	2: 163,415,581	E11K	probably damaging	Het
Pacsin3	A	G	2: 91,262,943		probably null	Het
Pcdh20	T	C	14: 88,468,998	S289G	probably benign	Het
Phlpp1	A	G	1: 106,386,446	D1183G	probably damaging	Het
Pign	T	C	1: 105,648,220	K232E	probably benign	Het
Polk	A	G	13: 96,493,905	S383P	probably damaging	Het
Prom2	C	A	2: 127,540,191	R101L	probably benign	Het
Rest	T	C	5: 77,281,180	V482A	probably benign	Het
Rexo1	A	T	10: 80,542,658	S476T	probably damaging	Het
Rnf31	T	A	14: 55,603,320	Y1015N	probably damaging	Het
Spata3	T	C	1: 86,026,430	Y305H	probably benign	Het
Sv2a	G	A	3: 96,192,494	V587M	probably benign	Het
Synj1	A	G	16: 90,969,181		probably null	Het
Syt17	A	G	7: 118,436,817		probably null	Het
Tcaf1	A	C	6: 42,679,314	S243A	probably benign	Het
Tmem9	A	G	1: 136,027,496	T123A	probably benign	Het
Trav4-4-dv10	T	C	14: 53,683,730		probably benign	Het
Trbv15	G	A	6: 41,141,559	R83Q	probably damaging	Het
Trim27	A	G	13: 21,189,886	I268V	probably benign	Het
Tubgcp6	T	A	15: 89,103,654	S1031C	probably damaging	Het
Vmn1r89	C	A	7: 13,219,872	H110Q	probably benign	Het
Vmn2r30	T	C	7: 7,317,092	N545S	probably damaging	Het
Wls	G	A	3: 159,897,383	M144I	probably benign	Het
Yme1l1	T	C	2: 23,186,332		probably null	Het
Zeb2	A	T	2: 45,023,011	L56Q	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACGTCCAAATCTGCATTCTATACTAC -3'
(R):5'- AAGATTAGGAAACTTTTGGGGTGAC -3'

Sequencing Primer
(F):5'- TTGAAACAGGTGTCACCATGCTG -3'
(R):5'- AGGAAACTTTTGGGGTGACTATTC -3'

Posted On

2015-07-21