Incidental Mutation 'R4472:Atg2a'
ID330439
Institutional Source Beutler Lab
Gene Symbol Atg2a
Ensembl Gene ENSMUSG00000024773
Gene Nameautophagy related 2A
Synonyms
MMRRC Submission 041729-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R4472 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6241668-6262335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6258955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1724 (V1724M)
Ref Sequence ENSEMBL: ENSMUSP00000046412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045351]
Predicted Effect probably damaging
Transcript: ENSMUST00000045351
AA Change: V1724M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: V1724M

DomainStartEndE-ValueType
Pfam:Chorein_N 14 131 7.6e-20 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
low complexity region 852 863 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1761 1773 N/A INTRINSIC
Pfam:ATG_C 1814 1908 2.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143053
Predicted Effect unknown
Transcript: ENSMUST00000145600
AA Change: V1527M
SMART Domains Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: V1527M

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 871 883 N/A INTRINSIC
low complexity region 1233 1250 N/A INTRINSIC
low complexity region 1565 1577 N/A INTRINSIC
Pfam:ATG_C 1618 1712 3.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151079
Meta Mutation Damage Score 0.2093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A T 9: 40,050,698 noncoding transcript Het
Accsl T A 2: 93,863,991 probably null Het
Accsl G T 2: 93,863,992 probably null Het
Adcy1 G A 11: 7,130,369 V371M probably damaging Het
Adgrb2 C T 4: 130,008,353 A509V probably benign Het
Adgrg6 T A 10: 14,436,781 Q754L probably damaging Het
Agap2 T C 10: 127,091,213 I1008T probably damaging Het
Aph1c T G 9: 66,827,769 H150P probably damaging Het
Atcay T C 10: 81,212,527 R242G possibly damaging Het
Bbs12 T C 3: 37,319,220 V54A possibly damaging Het
Card14 A G 11: 119,333,958 M604V possibly damaging Het
Cd28 A T 1: 60,763,234 H104L probably benign Het
Cntn5 A T 9: 10,048,771 D262E probably damaging Het
Col6a3 A G 1: 90,822,014 V366A probably benign Het
Csnk1d G A 11: 120,964,974 probably benign Het
Dcaf11 T A 14: 55,565,606 probably benign Het
Dpy19l4 G A 4: 11,304,053 T119M possibly damaging Het
Eif3f T C 7: 108,940,946 V316A possibly damaging Het
Fbrsl1 G A 5: 110,379,066 probably benign Het
Fbxo10 C T 4: 45,043,693 R710H probably damaging Het
Fbxw9 G A 8: 85,060,200 D25N probably damaging Het
Gm14295 C T 2: 176,809,593 T292I possibly damaging Het
Gm4884 C G 7: 41,043,263 Q219E probably benign Het
Gpr150 A G 13: 76,056,154 V224A probably benign Het
Hps1 A T 19: 42,762,496 I355N probably damaging Het
Lmbr1l A G 15: 98,906,297 S374P probably benign Het
Macf1 A T 4: 123,395,989 N5458K probably damaging Het
Man1b1 C G 2: 25,332,855 probably benign Het
Morc3 A G 16: 93,874,757 probably null Het
Mrgpra4 T C 7: 47,981,791 T21A probably benign Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Nkain4 C G 2: 180,954,622 M1I probably null Het
Nktr T C 9: 121,748,896 probably benign Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Oas2 A T 5: 120,741,155 D373E possibly damaging Het
Olfr970 T A 9: 39,820,574 *312R probably null Het
Oser1 T A 2: 163,415,580 E11V probably null Het
Oser1 C T 2: 163,415,581 E11K probably damaging Het
Pacsin3 A G 2: 91,262,943 probably null Het
Pcdh20 T C 14: 88,468,998 S289G probably benign Het
Phlpp1 A G 1: 106,386,446 D1183G probably damaging Het
Pign T C 1: 105,648,220 K232E probably benign Het
Polk A G 13: 96,493,905 S383P probably damaging Het
Prom2 C A 2: 127,540,191 R101L probably benign Het
Rest T C 5: 77,281,180 V482A probably benign Het
Rexo1 A T 10: 80,542,658 S476T probably damaging Het
Rnf31 T A 14: 55,603,320 Y1015N probably damaging Het
Spata3 T C 1: 86,026,430 Y305H probably benign Het
Sv2a G A 3: 96,192,494 V587M probably benign Het
Synj1 A G 16: 90,969,181 probably null Het
Syt17 A G 7: 118,436,817 probably null Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tcaf1 A C 6: 42,679,314 S243A probably benign Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trav4-4-dv10 T C 14: 53,683,730 probably benign Het
Trbv15 G A 6: 41,141,559 R83Q probably damaging Het
Trim27 A G 13: 21,189,886 I268V probably benign Het
Tubgcp6 T A 15: 89,103,654 S1031C probably damaging Het
Vmn1r89 C A 7: 13,219,872 H110Q probably benign Het
Vmn2r30 T C 7: 7,317,092 N545S probably damaging Het
Wls G A 3: 159,897,383 M144I probably benign Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zeb2 A T 2: 45,023,011 L56Q probably damaging Het
Other mutations in Atg2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Atg2a APN 19 6254599 missense probably damaging 1.00
IGL01612:Atg2a APN 19 6252484 missense probably benign 0.03
IGL02105:Atg2a APN 19 6250403 splice site probably benign
IGL02151:Atg2a APN 19 6255757 missense possibly damaging 0.95
IGL02228:Atg2a APN 19 6246800 missense probably benign 0.29
IGL02329:Atg2a APN 19 6249929 critical splice donor site probably null
IGL02408:Atg2a APN 19 6241828 nonsense probably null
IGL02538:Atg2a APN 19 6257628 missense probably benign
IGL02830:Atg2a APN 19 6247681 missense probably benign 0.04
IGL03349:Atg2a APN 19 6258024 missense possibly damaging 0.77
PIT4515001:Atg2a UTSW 19 6253585 missense probably damaging 1.00
R0099:Atg2a UTSW 19 6252789 missense probably damaging 0.97
R0212:Atg2a UTSW 19 6246554 missense probably damaging 1.00
R0365:Atg2a UTSW 19 6247683 missense possibly damaging 0.51
R0398:Atg2a UTSW 19 6246578 missense probably damaging 1.00
R0483:Atg2a UTSW 19 6256601 missense probably damaging 0.98
R0483:Atg2a UTSW 19 6256602 missense probably benign 0.01
R0494:Atg2a UTSW 19 6253377 missense probably damaging 1.00
R0511:Atg2a UTSW 19 6252539 missense possibly damaging 0.89
R0590:Atg2a UTSW 19 6245007 unclassified probably benign
R0592:Atg2a UTSW 19 6245007 unclassified probably benign
R0593:Atg2a UTSW 19 6245007 unclassified probably benign
R0630:Atg2a UTSW 19 6244517 missense probably damaging 0.99
R1306:Atg2a UTSW 19 6253021 missense probably benign 0.31
R1437:Atg2a UTSW 19 6250616 missense probably damaging 1.00
R1539:Atg2a UTSW 19 6246771 splice site probably null
R1774:Atg2a UTSW 19 6250598 missense probably benign 0.01
R1781:Atg2a UTSW 19 6256213 missense probably damaging 0.96
R1854:Atg2a UTSW 19 6252431 missense probably benign 0.11
R1884:Atg2a UTSW 19 6254384 missense probably damaging 1.00
R1899:Atg2a UTSW 19 6245067 missense probably damaging 1.00
R1935:Atg2a UTSW 19 6252536 missense probably damaging 1.00
R2020:Atg2a UTSW 19 6250269 critical splice donor site probably null
R2071:Atg2a UTSW 19 6257458 missense probably benign 0.00
R2513:Atg2a UTSW 19 6258046 critical splice donor site probably null
R3808:Atg2a UTSW 19 6252816 missense possibly damaging 0.71
R4065:Atg2a UTSW 19 6258366 missense probably damaging 1.00
R4109:Atg2a UTSW 19 6258374 missense possibly damaging 0.95
R4352:Atg2a UTSW 19 6257457 missense probably benign 0.04
R4440:Atg2a UTSW 19 6255829 critical splice donor site probably null
R4669:Atg2a UTSW 19 6258987 critical splice donor site probably null
R4878:Atg2a UTSW 19 6250244 missense probably damaging 1.00
R4926:Atg2a UTSW 19 6257533 missense probably damaging 0.96
R5237:Atg2a UTSW 19 6246814 missense probably benign
R5350:Atg2a UTSW 19 6251338 missense probably damaging 0.99
R5507:Atg2a UTSW 19 6245070 missense possibly damaging 0.94
R5732:Atg2a UTSW 19 6257460 missense probably damaging 1.00
R5784:Atg2a UTSW 19 6261505 missense probably damaging 1.00
R5960:Atg2a UTSW 19 6254360 missense probably damaging 1.00
R5985:Atg2a UTSW 19 6254637 missense probably damaging 1.00
R6175:Atg2a UTSW 19 6241729 unclassified probably benign
R6572:Atg2a UTSW 19 6254665 missense probably damaging 0.98
R6878:Atg2a UTSW 19 6250178 missense probably damaging 0.99
R6879:Atg2a UTSW 19 6251852 missense possibly damaging 0.70
R6983:Atg2a UTSW 19 6260040 missense probably damaging 0.99
R7024:Atg2a UTSW 19 6250219 missense possibly damaging 0.88
R7217:Atg2a UTSW 19 6253441 critical splice donor site probably null
R7384:Atg2a UTSW 19 6261677 missense probably damaging 1.00
R7387:Atg2a UTSW 19 6255168 missense possibly damaging 0.79
R7425:Atg2a UTSW 19 6255652 missense probably benign 0.02
R7512:Atg2a UTSW 19 6260076 missense probably damaging 1.00
R7658:Atg2a UTSW 19 6251263 missense probably damaging 1.00
R7893:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R8062:Atg2a UTSW 19 6252579 critical splice donor site probably null
R8258:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8259:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8350:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8412:Atg2a UTSW 19 6244524 missense probably damaging 1.00
R8450:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8474:Atg2a UTSW 19 6251403 critical splice donor site probably null
R8501:Atg2a UTSW 19 6254390 missense probably damaging 1.00
R8738:Atg2a UTSW 19 6256644 missense probably benign 0.00
R8786:Atg2a UTSW 19 6244430 missense probably damaging 1.00
R8810:Atg2a UTSW 19 6250621 missense probably benign 0.01
X0065:Atg2a UTSW 19 6258196 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCACAGCACTGGGTAAGAC -3'
(R):5'- AAAGCACAGGCCAGGTATGC -3'

Sequencing Primer
(F):5'- CCCTGGGGTGAATAGGTGCTC -3'
(R):5'- ACTCTCTGAGTCCAGGAACAGTG -3'
Posted On2015-07-21