Incidental Mutation 'R4473:Fastkd2'
ID 330441
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene Name FAST kinase domains 2
Synonyms 2810421I24Rik
MMRRC Submission 041730-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4473 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63769758-63792544 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63770833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 63 (L63P)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103] [ENSMUST00000114094]
AlphaFold Q922E6
Predicted Effect probably damaging
Transcript: ENSMUST00000027103
AA Change: L63P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: L63P

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114094
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148758
Meta Mutation Damage Score 0.7843 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,291,313 (GRCm39) T93K probably damaging Het
Actg1 G A 11: 120,239,085 (GRCm39) R2C probably benign Het
Alb T C 5: 90,611,912 (GRCm39) C114R probably damaging Het
Alpk1 T C 3: 127,473,667 (GRCm39) T779A probably damaging Het
Atp2a2 A T 5: 122,595,327 (GRCm39) S1008T probably benign Het
Corin T C 5: 72,496,400 (GRCm39) S510G probably damaging Het
D630003M21Rik G A 2: 158,055,382 (GRCm39) P585L probably damaging Het
Eddm3b A G 14: 51,354,236 (GRCm39) T75A probably benign Het
Elavl2 T C 4: 91,149,246 (GRCm39) probably null Het
Erc1 G T 6: 119,825,417 (GRCm39) probably null Het
Fancf A G 7: 51,511,948 (GRCm39) C19R probably benign Het
Fmo1 A G 1: 162,677,732 (GRCm39) V128A possibly damaging Het
Ifnar1 T C 16: 91,292,058 (GRCm39) V133A probably damaging Het
Ighv1-49 A T 12: 115,018,959 (GRCm39) Y79N probably damaging Het
Klhl23 A G 2: 69,654,151 (GRCm39) E7G possibly damaging Het
Mthfd2 A G 6: 83,287,517 (GRCm39) probably benign Het
Or5d35 T A 2: 87,855,464 (GRCm39) Y133N probably damaging Het
Parn A G 16: 13,482,549 (GRCm39) S100P probably benign Het
Podnl1 A T 8: 84,858,614 (GRCm39) I505F possibly damaging Het
Ppp6r3 G T 19: 3,561,978 (GRCm39) Q228K probably damaging Het
Pramel38 A G 5: 94,366,029 (GRCm39) N49S probably benign Het
Rab22a C T 2: 173,537,056 (GRCm39) T85M probably damaging Het
Siah1b G A X: 162,854,688 (GRCm39) P131S probably damaging Het
Skor2 C T 18: 76,947,156 (GRCm39) P293S unknown Het
Sox18 T C 2: 181,312,669 (GRCm39) K154R probably damaging Het
Tfpi A T 2: 84,288,426 (GRCm39) L10Q probably null Het
Trim66 A T 7: 109,081,202 (GRCm39) I239N probably damaging Het
Ttll1 T A 15: 83,376,810 (GRCm39) K304N probably damaging Het
Vmn1r5 G A 6: 56,962,633 (GRCm39) V103I probably benign Het
Vnn1 T C 10: 23,770,789 (GRCm39) W6R probably benign Het
Wdr35 A G 12: 9,065,995 (GRCm39) Y651C probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63,776,930 (GRCm39) splice site probably benign
IGL01890:Fastkd2 APN 1 63,771,320 (GRCm39) missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63,787,158 (GRCm39) missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63,777,083 (GRCm39) splice site probably benign
IGL03208:Fastkd2 APN 1 63,778,365 (GRCm39) missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63,771,187 (GRCm39) missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63,791,559 (GRCm39) missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63,776,970 (GRCm39) missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63,791,499 (GRCm39) missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63,787,114 (GRCm39) splice site probably benign
R1468:Fastkd2 UTSW 1 63,771,385 (GRCm39) unclassified probably benign
R1579:Fastkd2 UTSW 1 63,785,046 (GRCm39) missense probably null 0.00
R1729:Fastkd2 UTSW 1 63,790,459 (GRCm39) nonsense probably null
R3937:Fastkd2 UTSW 1 63,776,995 (GRCm39) missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63,791,516 (GRCm39) missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63,774,968 (GRCm39) intron probably benign
R4760:Fastkd2 UTSW 1 63,785,045 (GRCm39) missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63,789,055 (GRCm39) intron probably benign
R5176:Fastkd2 UTSW 1 63,770,598 (GRCm39) unclassified probably benign
R5478:Fastkd2 UTSW 1 63,778,345 (GRCm39) missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63,778,469 (GRCm39) missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63,770,953 (GRCm39) missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63,771,032 (GRCm39) missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63,771,009 (GRCm39) missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63,776,948 (GRCm39) missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63,770,851 (GRCm39) missense possibly damaging 0.61
R7889:Fastkd2 UTSW 1 63,774,619 (GRCm39) splice site probably null
R8263:Fastkd2 UTSW 1 63,770,968 (GRCm39) missense probably benign 0.03
R8271:Fastkd2 UTSW 1 63,787,183 (GRCm39) missense probably benign 0.26
R8321:Fastkd2 UTSW 1 63,787,138 (GRCm39) missense probably benign 0.00
R8468:Fastkd2 UTSW 1 63,770,923 (GRCm39) missense probably benign 0.06
R8767:Fastkd2 UTSW 1 63,775,080 (GRCm39) missense probably benign 0.00
Z1177:Fastkd2 UTSW 1 63,773,996 (GRCm39) critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63,773,995 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGTTATGGACCATCCGACG -3'
(R):5'- CACAGGGGTTGGTCTTACTTTC -3'

Sequencing Primer
(F):5'- GTTATGGACCATCCGACGATTCAG -3'
(R):5'- CTTGGTGAACACATCTTCACTGGAG -3'
Posted On 2015-07-21