Incidental Mutation 'R4473:Fmo1'
ID330442
Institutional Source Beutler Lab
Gene Symbol Fmo1
Ensembl Gene ENSMUSG00000040181
Gene Nameflavin containing monooxygenase 1
Synonyms
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162829561-162866610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162850163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000117398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046049] [ENSMUST00000111518] [ENSMUST00000131058] [ENSMUST00000134098] [ENSMUST00000193078]
Predicted Effect probably benign
Transcript: ENSMUST00000046049
AA Change: V128A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037259
Gene: ENSMUSG00000040181
AA Change: V128A

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 1.5e-279 PFAM
Pfam:Pyr_redox_2 3 228 3.8e-13 PFAM
Pfam:NAD_binding_8 7 63 8e-7 PFAM
Pfam:K_oxygenase 73 226 3.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111518
AA Change: V128A

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107143
Gene: ENSMUSG00000040181
AA Change: V128A

DomainStartEndE-ValueType
Pfam:FMO-like 2 170 4.6e-93 PFAM
Pfam:Pyr_redox_3 6 173 2.7e-8 PFAM
Pfam:NAD_binding_8 7 65 5.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131058
AA Change: V128A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118534
Gene: ENSMUSG00000040181
AA Change: V128A

DomainStartEndE-ValueType
Pfam:FMO-like 2 209 9.3e-122 PFAM
Pfam:Pyr_redox_2 4 208 8.2e-9 PFAM
Pfam:Pyr_redox_3 6 209 7.5e-16 PFAM
Pfam:NAD_binding_8 7 65 5.2e-8 PFAM
Pfam:K_oxygenase 72 209 1.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134098
AA Change: V128A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117398
Gene: ENSMUSG00000040181
AA Change: V128A

DomainStartEndE-ValueType
Pfam:FMO-like 2 303 1.4e-168 PFAM
Pfam:Pyr_redox_2 4 280 8e-9 PFAM
Pfam:Pyr_redox_3 6 220 5.5e-16 PFAM
Pfam:NAD_binding_8 7 65 9.5e-8 PFAM
Pfam:K_oxygenase 72 224 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193078
AA Change: V128A

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141210
Gene: ENSMUSG00000040181
AA Change: V128A

DomainStartEndE-ValueType
Pfam:FMO-like 2 230 9.4e-132 PFAM
Pfam:Pyr_redox_2 4 223 4.9e-7 PFAM
Pfam:Pyr_redox_3 6 220 3.1e-14 PFAM
Pfam:NAD_binding_8 7 65 6.9e-6 PFAM
Pfam:K_oxygenase 72 222 3.8e-8 PFAM
Meta Mutation Damage Score 0.4570 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Fmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Fmo1 APN 1 162836246 missense probably damaging 1.00
IGL00479:Fmo1 APN 1 162830063 missense probably benign 0.00
IGL01612:Fmo1 APN 1 162833599 missense probably benign 0.42
IGL01650:Fmo1 APN 1 162833584 missense probably benign 0.04
IGL02052:Fmo1 APN 1 162850060 critical splice donor site probably null
IGL02340:Fmo1 APN 1 162832990 missense probably benign 0.02
IGL03348:Fmo1 APN 1 162850151 missense possibly damaging 0.76
IGL03388:Fmo1 APN 1 162836147 missense probably benign 0.17
PIT1430001:Fmo1 UTSW 1 162830053 missense probably benign 0.00
R0279:Fmo1 UTSW 1 162830272 missense possibly damaging 0.92
R0314:Fmo1 UTSW 1 162859462 missense probably damaging 1.00
R0348:Fmo1 UTSW 1 162836135 missense probably benign 0.00
R0385:Fmo1 UTSW 1 162836204 missense possibly damaging 0.94
R0699:Fmo1 UTSW 1 162833772 missense probably benign 0.00
R1413:Fmo1 UTSW 1 162833862 missense probably damaging 0.98
R1424:Fmo1 UTSW 1 162830066 missense probably damaging 1.00
R1430:Fmo1 UTSW 1 162839724 missense probably damaging 1.00
R1851:Fmo1 UTSW 1 162829985 nonsense probably null
R1929:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R1982:Fmo1 UTSW 1 162839756 missense possibly damaging 0.83
R2272:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R2568:Fmo1 UTSW 1 162836259 missense probably benign 0.00
R3787:Fmo1 UTSW 1 162830014 missense possibly damaging 0.54
R3825:Fmo1 UTSW 1 162851347 splice site probably benign
R3904:Fmo1 UTSW 1 162833768 missense possibly damaging 0.54
R4320:Fmo1 UTSW 1 162833631 missense probably damaging 1.00
R4367:Fmo1 UTSW 1 162833648 nonsense probably null
R4431:Fmo1 UTSW 1 162833712 missense possibly damaging 0.76
R5340:Fmo1 UTSW 1 162829982 missense probably benign 0.39
R5354:Fmo1 UTSW 1 162830145 missense probably benign 0.01
R5479:Fmo1 UTSW 1 162850224 missense probably damaging 0.99
R5930:Fmo1 UTSW 1 162839616 critical splice donor site probably null
R6148:Fmo1 UTSW 1 162851519 missense probably damaging 0.99
R6160:Fmo1 UTSW 1 162836298 missense probably benign 0.00
R6164:Fmo1 UTSW 1 162851410 missense probably benign 0.24
R6263:Fmo1 UTSW 1 162850060 critical splice donor site probably null
R7046:Fmo1 UTSW 1 162839694 missense possibly damaging 0.92
R7590:Fmo1 UTSW 1 162859682 intron probably benign
R7663:Fmo1 UTSW 1 162836297 missense possibly damaging 0.74
R7692:Fmo1 UTSW 1 162833833 missense probably benign 0.16
R7712:Fmo1 UTSW 1 162836135 missense probably benign 0.00
X0022:Fmo1 UTSW 1 162830000 missense possibly damaging 0.57
X0066:Fmo1 UTSW 1 162839704 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTAACGGACAATCCACAAGAG -3'
(R):5'- GAAGCCTTCTATCCAATGAATCTTG -3'

Sequencing Primer
(F):5'- TCCACAAGAGTTCATCCTGGG -3'
(R):5'- AATGAATCTTGTTTGATTTGGTAGCC -3'
Posted On2015-07-21