Incidental Mutation 'R4473:Klhl23'
ID330443
Institutional Source Beutler Lab
Gene Symbol Klhl23
Ensembl Gene ENSMUSG00000042155
Gene Namekelch-like 23
Synonyms
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69821944-69836651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69823807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 7 (E7G)
Ref Sequence ENSEMBL: ENSMUSP00000050219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053087
AA Change: E7G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050219
Gene: ENSMUSG00000042155
AA Change: E7G

DomainStartEndE-ValueType
BTB 36 134 8.34e-27 SMART
BACK 139 240 8.51e-23 SMART
Kelch 274 319 5.19e0 SMART
Kelch 321 369 5.85e-10 SMART
Kelch 370 416 7.78e-6 SMART
Kelch 417 466 2.11e-1 SMART
Kelch 467 508 3.8e-9 SMART
Kelch 509 557 2.25e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152898
Meta Mutation Damage Score 0.0881 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Klhl23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Klhl23 APN 2 69824238 missense probably damaging 1.00
IGL02637:Klhl23 APN 2 69828914 nonsense probably null
R0128:Klhl23 UTSW 2 69833966 missense probably damaging 0.97
R0130:Klhl23 UTSW 2 69833966 missense probably damaging 0.97
R0333:Klhl23 UTSW 2 69833897 missense probably damaging 1.00
R0538:Klhl23 UTSW 2 69824413 missense probably benign 0.01
R1466:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1466:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1584:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1970:Klhl23 UTSW 2 69833686 missense probably damaging 1.00
R2102:Klhl23 UTSW 2 69828884 missense probably damaging 1.00
R4236:Klhl23 UTSW 2 69824172 missense probably damaging 0.98
R5446:Klhl23 UTSW 2 69824238 missense probably damaging 1.00
R5852:Klhl23 UTSW 2 69824269 missense probably benign 0.44
R6143:Klhl23 UTSW 2 69833696 missense possibly damaging 0.65
R6151:Klhl23 UTSW 2 69824854 missense probably damaging 0.99
R6277:Klhl23 UTSW 2 69833752 missense probably damaging 1.00
R7030:Klhl23 UTSW 2 69833966 missense probably damaging 1.00
R7303:Klhl23 UTSW 2 69824701 missense probably benign 0.42
R7724:Klhl23 UTSW 2 69824712 missense probably benign 0.00
X0066:Klhl23 UTSW 2 69823788 start codon destroyed possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGCGCATTTTGCATATGGTG -3'
(R):5'- ATATCATGGTGGATGCCCGAC -3'

Sequencing Primer
(F):5'- CATTTTGCATATGGTGTTTGGGCATC -3'
(R):5'- ATGTCAGCTGTGAACATTGCC -3'
Posted On2015-07-21