Incidental Mutation 'R4473:Olfr1161'
ID330445
Institutional Source Beutler Lab
Gene Symbol Olfr1161
Ensembl Gene ENSMUSG00000045150
Gene Nameolfactory receptor 1161
SynonymsMOR174-2, GA_x6K02T2Q125-49516664-49517629
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88022774-88028252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88025120 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 133 (Y133N)
Ref Sequence ENSEMBL: ENSMUSP00000150220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054845] [ENSMUST00000214438] [ENSMUST00000217006]
Predicted Effect probably damaging
Transcript: ENSMUST00000054845
AA Change: Y133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060977
Gene: ENSMUSG00000045150
AA Change: Y133N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.8e-52 PFAM
Pfam:7tm_1 42 291 9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214438
AA Change: Y133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217006
AA Change: Y133N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6469 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Olfr1161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr1161 APN 2 88025003 missense probably benign 0.23
IGL01564:Olfr1161 APN 2 88025304 missense probably benign 0.00
IGL01588:Olfr1161 APN 2 88025073 missense probably benign
R0268:Olfr1161 UTSW 2 88025468 missense probably damaging 0.99
R1587:Olfr1161 UTSW 2 88025133 missense probably damaging 1.00
R1995:Olfr1161 UTSW 2 88025672 missense probably benign 0.06
R2249:Olfr1161 UTSW 2 88025363 missense probably damaging 0.98
R3813:Olfr1161 UTSW 2 88024761 missense probably damaging 1.00
R4772:Olfr1161 UTSW 2 88024863 missense probably damaging 0.99
R4787:Olfr1161 UTSW 2 88024860 missense possibly damaging 0.79
R4870:Olfr1161 UTSW 2 88025460 missense probably damaging 1.00
R5260:Olfr1161 UTSW 2 88025474 missense probably benign 0.02
R5896:Olfr1161 UTSW 2 88025121 missense probably damaging 0.98
R6262:Olfr1161 UTSW 2 88025394 missense probably benign 0.00
R7330:Olfr1161 UTSW 2 88024921 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CATTGCTCCCAAGATGCTGG -3'
(R):5'- AGAGTACTAAGAGCATTCACAGTAG -3'

Sequencing Primer
(F):5'- TCCCAAGATGCTGGTGAATC -3'
(R):5'- CTAAGAGCATTCACAGTAGAAAGTG -3'
Posted On2015-07-21