Incidental Mutation 'R4473:Sox18'
ID330448
Institutional Source Beutler Lab
Gene Symbol Sox18
Ensembl Gene ENSMUSG00000046470
Gene NameSRY (sex determining region Y)-box 18
SynonymsSry-related HMG-box gene 18, Ragl
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4473 (G1)
Quality Score166
Status Validated
Chromosome2
Chromosomal Location181669836-181671640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181670876 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 154 (K154R)
Ref Sequence ENSEMBL: ENSMUSP00000062759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054491]
Predicted Effect probably damaging
Transcript: ENSMUST00000054491
AA Change: K154R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062759
Gene: ENSMUSG00000046470
AA Change: K154R

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
HMG 78 148 4.08e-27 SMART
low complexity region 159 172 N/A INTRINSIC
Pfam:Sox_C_TAD 186 375 2.2e-52 PFAM
Meta Mutation Damage Score 0.1487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for some mutant alleles show low prenatal viability and cardiovascular defects. Most mutants show darkened coats, reduced zigzag hairs and, depending on the allele, sparse abnormal hair and edema. Heterozygotes show similar or milder defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Sox18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sox18 APN 2 181670420 missense probably benign
IGL01691:Sox18 APN 2 181671350 missense possibly damaging 0.85
nandou UTSW 2 181670895 missense probably damaging 1.00
R4476:Sox18 UTSW 2 181670876 missense probably damaging 0.97
R4710:Sox18 UTSW 2 181670895 missense probably damaging 1.00
R4949:Sox18 UTSW 2 181671224 nonsense probably null
R5249:Sox18 UTSW 2 181671178 splice site probably null
R7056:Sox18 UTSW 2 181671487 missense probably damaging 0.99
R7083:Sox18 UTSW 2 181670372 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATAGTAGAGACCTGCGAGTGG -3'
(R):5'- TATGCCATGTTTCACGCCG -3'

Sequencing Primer
(F):5'- CATAGGGTGCCCGGAAAGC -3'
(R):5'- CACGACGGTTTGGCTAGTC -3'
Posted On2015-07-21