Incidental Mutation 'R4473:Elavl2'
ID330450
Institutional Source Beutler Lab
Gene Symbol Elavl2
Ensembl Gene ENSMUSG00000008489
Gene NameELAV like RNA binding protein 1
Synonymsmel-N1, Hub
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location91250763-91400785 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 91261009 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008633] [ENSMUST00000102799] [ENSMUST00000107109] [ENSMUST00000107109] [ENSMUST00000107110] [ENSMUST00000107111] [ENSMUST00000107111] [ENSMUST00000107116] [ENSMUST00000107116] [ENSMUST00000107118] [ENSMUST00000107118] [ENSMUST00000107120] [ENSMUST00000107120] [ENSMUST00000107124] [ENSMUST00000177109]
Predicted Effect probably null
Transcript: ENSMUST00000008633
SMART Domains Protein: ENSMUSP00000008633
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 278 351 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102799
SMART Domains Protein: ENSMUSP00000099863
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 54 127 1.44e-24 SMART
RRM 140 215 2.35e-20 SMART
RRM 291 364 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107109
SMART Domains Protein: ENSMUSP00000102726
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107109
SMART Domains Protein: ENSMUSP00000102726
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107110
SMART Domains Protein: ENSMUSP00000102727
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 265 338 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107111
SMART Domains Protein: ENSMUSP00000102728
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 264 337 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107111
SMART Domains Protein: ENSMUSP00000102728
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 264 337 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107116
SMART Domains Protein: ENSMUSP00000102733
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 307 380 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107116
SMART Domains Protein: ENSMUSP00000102733
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 307 380 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107118
SMART Domains Protein: ENSMUSP00000102735
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 294 367 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107118
SMART Domains Protein: ENSMUSP00000102735
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 294 367 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107120
SMART Domains Protein: ENSMUSP00000102737
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 306 379 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107120
SMART Domains Protein: ENSMUSP00000102737
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 69 142 1.44e-24 SMART
RRM 155 230 2.35e-20 SMART
RRM 306 379 5.15e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107124
SMART Domains Protein: ENSMUSP00000102741
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
RRM 126 201 2.35e-20 SMART
RRM 277 350 5.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176469
Predicted Effect probably benign
Transcript: ENSMUST00000177109
SMART Domains Protein: ENSMUSP00000135780
Gene: ENSMUSG00000008489

DomainStartEndE-ValueType
RRM 40 113 1.44e-24 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a neural-specific RNA-binding protein that is known to bind to several 3' UTRs, including its own and also that of FOS and ID. The encoded protein may recognize a GAAA motif in the RNA. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Elavl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Elavl2 APN 4 91264072 missense probably damaging 1.00
IGL01886:Elavl2 APN 4 91264093 missense probably damaging 1.00
IGL02016:Elavl2 APN 4 91260935 missense probably damaging 1.00
IGL02024:Elavl2 APN 4 91253539 missense probably benign 0.02
IGL02860:Elavl2 APN 4 91260953 missense probably damaging 1.00
R0458:Elavl2 UTSW 4 91308867 splice site probably benign
R1294:Elavl2 UTSW 4 91311589 missense probably benign 0.02
R1778:Elavl2 UTSW 4 91253478 missense probably damaging 1.00
R2063:Elavl2 UTSW 4 91253450 missense possibly damaging 0.81
R2190:Elavl2 UTSW 4 91264094 missense probably benign 0.22
R3773:Elavl2 UTSW 4 91264088 missense probably damaging 1.00
R4784:Elavl2 UTSW 4 91254142 missense probably null 0.97
R4911:Elavl2 UTSW 4 91308678 missense possibly damaging 0.91
R5396:Elavl2 UTSW 4 91260818 missense probably damaging 1.00
R6708:Elavl2 UTSW 4 91253397 missense probably damaging 1.00
R6882:Elavl2 UTSW 4 91308715 missense probably damaging 1.00
R7592:Elavl2 UTSW 4 91311571 critical splice donor site probably null
R7849:Elavl2 UTSW 4 91372043 unclassified probably benign
R7932:Elavl2 UTSW 4 91372043 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGAAAGGATGGCCTGATTG -3'
(R):5'- GGTTTCTTGACAAGCACACGG -3'

Sequencing Primer
(F):5'- TCTGGCCATTTAGGCCTT -3'
(R):5'- GTAACCAGTGAGACCTCGCATTG -3'
Posted On2015-07-21