Incidental Mutation 'R4473:Acot7'
ID330451
Institutional Source Beutler Lab
Gene Symbol Acot7
Ensembl Gene ENSMUSG00000028937
Gene Nameacyl-CoA thioesterase 7
Synonyms2410041A17Rik, Bach, AU014716
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4473 (G1)
Quality Score183
Status Validated
Chromosome4
Chromosomal Location152178134-152271855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 152206856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 93 (T93K)
Ref Sequence ENSEMBL: ENSMUSP00000129121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030779] [ENSMUST00000075363] [ENSMUST00000105652] [ENSMUST00000167926]
Predicted Effect probably damaging
Transcript: ENSMUST00000030779
AA Change: T90K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030779
Gene: ENSMUSG00000028937
AA Change: T90K

DomainStartEndE-ValueType
Pfam:4HBT 69 152 1e-16 PFAM
Pfam:4HBT 243 318 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075363
AA Change: T88K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937
AA Change: T88K

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:4HBT 67 150 1.2e-16 PFAM
Pfam:4HBT 241 316 5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105652
AA Change: T59K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101277
Gene: ENSMUSG00000028937
AA Change: T59K

DomainStartEndE-ValueType
Pfam:4HBT 38 121 1.1e-16 PFAM
Pfam:4HBT 212 287 4.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144733
Predicted Effect probably damaging
Transcript: ENSMUST00000167926
AA Change: T93K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129121
Gene: ENSMUSG00000028937
AA Change: T93K

DomainStartEndE-ValueType
Pfam:4HBT 72 155 2.3e-17 PFAM
Pfam:4HBT 246 320 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184331
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Acot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Acot7 APN 4 152260896 missense probably benign 0.39
IGL01758:Acot7 APN 4 152217793 missense probably damaging 0.96
IGL01991:Acot7 APN 4 152223079 missense possibly damaging 0.84
R1329:Acot7 UTSW 4 152229784 nonsense probably null
R1605:Acot7 UTSW 4 152206828 missense possibly damaging 0.46
R1625:Acot7 UTSW 4 152186291 missense probably benign 0.01
R1739:Acot7 UTSW 4 152260912 missense probably damaging 1.00
R4169:Acot7 UTSW 4 152217793 missense probably damaging 0.96
R4857:Acot7 UTSW 4 152237754 missense possibly damaging 0.76
R4884:Acot7 UTSW 4 152186207 intron probably benign
R5000:Acot7 UTSW 4 152186363 missense probably benign 0.00
R6123:Acot7 UTSW 4 152199945 missense probably benign
R6633:Acot7 UTSW 4 152178259 missense probably benign
R6938:Acot7 UTSW 4 152217894 critical splice donor site probably null
R7025:Acot7 UTSW 4 152178189 missense unknown
R7813:Acot7 UTSW 4 152223118 missense probably damaging 1.00
R8035:Acot7 UTSW 4 152253154 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATTCATGTCCTTCCTGTGGG -3'
(R):5'- GACCTCCAGAAGACACAGTG -3'

Sequencing Primer
(F):5'- AGCGAGTCCCTGCTGTACTTG -3'
(R):5'- CACAGTGGGTGGGCAAG -3'
Posted On2015-07-21