Mutagenetix > Incidental Mutations

Incidental Mutation 'R4473:Corin'

330452

Institutional Source

Beutler Lab

Gene Symbol

Corin

Ensembl Gene

ENSMUSG00000005220

Gene Name

corin

Synonyms

Lrp4

MMRRC Submission

041730-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R4473 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

72300025-72504473 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72339057 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 510 (S510G)

Ref Sequence

ENSEMBL: ENSMUSP00000135889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005352
AA Change: S651G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: S651G

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
FRI	205	318	6.15e-11	SMART
LDLa	336	372	1.31e-8	SMART
LDLa	373	408	1.5e-8	SMART
LDLa	409	447	5.47e-11	SMART
LDLa	448	484	1.22e-8	SMART
low complexity region	508	521	N/A	INTRINSIC
FRI	522	643	2.75e-31	SMART
LDLa	647	684	2.19e-10	SMART
LDLa	685	722	1.76e-5	SMART
LDLa	723	759	4.18e-7	SMART
SR	758	853	3.99e-10	SMART
Tryp_SPc	868	1097	5.45e-76	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167460
AA Change: S585G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: S585G

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	342	1.5e-8	SMART
LDLa	343	381	5.47e-11	SMART
LDLa	382	418	1.22e-8	SMART
low complexity region	442	455	N/A	INTRINSIC
FRI	456	577	2.75e-31	SMART
LDLa	581	618	2.19e-10	SMART
LDLa	619	656	1.76e-5	SMART
LDLa	657	693	4.18e-7	SMART
SR	692	787	3.99e-10	SMART
Tryp_SPc	802	1031	5.45e-76	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000175766
AA Change: S510G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: S510G

Domain	Start	End	E-Value	Type
transmembrane domain	45	67	N/A	INTRINSIC
FRI	137	250	6.15e-11	SMART
LDLa	268	304	1.31e-8	SMART
LDLa	305	343	2.07e-11	SMART
low complexity region	367	380	N/A	INTRINSIC
FRI	381	502	2.75e-31	SMART
LDLa	506	543	2.19e-10	SMART
LDLa	544	581	1.76e-5	SMART
LDLa	582	618	4.18e-7	SMART
SR	617	712	3.99e-10	SMART
Tryp_SPc	727	956	5.45e-76	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176396

Predicted Effect

probably benign
Transcript: ENSMUST00000176974
AA Change: S548G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: S548G

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	139	252	6.15e-11	SMART
LDLa	270	306	1.31e-8	SMART
LDLa	307	344	3.86e-11	SMART
LDLa	345	381	1.22e-8	SMART
low complexity region	405	418	N/A	INTRINSIC
FRI	419	540	2.75e-31	SMART
LDLa	544	581	2.19e-10	SMART
LDLa	582	619	1.76e-5	SMART
LDLa	620	656	4.18e-7	SMART
SR	655	750	3.99e-10	SMART
Tryp_SPc	765	994	5.45e-76	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177290
AA Change: S518G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: S518G

Domain	Start	End	E-Value	Type
transmembrane domain	47	69	N/A	INTRINSIC
FRI	72	185	6.15e-11	SMART
LDLa	203	239	1.31e-8	SMART
LDLa	240	275	1.5e-8	SMART
LDLa	276	314	5.47e-11	SMART
LDLa	315	351	1.22e-8	SMART
low complexity region	375	388	N/A	INTRINSIC
FRI	389	510	2.75e-31	SMART
LDLa	514	551	2.19e-10	SMART
LDLa	552	589	1.76e-5	SMART
LDLa	590	626	4.18e-7	SMART
SR	625	720	3.99e-10	SMART
Tryp_SPc	735	964	5.45e-76	SMART

Meta Mutation Damage Score

0.3195

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot7	C	A	4: 152,206,856	T93K	probably damaging	Het
Actg1	G	A	11: 120,348,259	R2C	probably benign	Het
Alb	T	C	5: 90,464,053	C114R	probably damaging	Het
Alpk1	T	C	3: 127,680,018	T779A	probably damaging	Het
Atp2a2	A	T	5: 122,457,264	S1008T	probably benign	Het
D630003M21Rik	G	A	2: 158,213,462	P585L	probably damaging	Het
Eddm3b	A	G	14: 51,116,779	T75A	probably benign	Het
Elavl2	T	C	4: 91,261,009		probably null	Het
Erc1	G	T	6: 119,848,456		probably null	Het
Fancf	A	G	7: 51,862,200	C19R	probably benign	Het
Fastkd2	T	C	1: 63,731,674	L63P	probably damaging	Het
Fmo1	A	G	1: 162,850,163	V128A	possibly damaging	Het
Gm3106	A	G	5: 94,218,170	N49S	probably benign	Het
Ifnar1	T	C	16: 91,495,170	V133A	probably damaging	Het
Ighv1-49	A	T	12: 115,055,339	Y79N	probably damaging	Het
Klhl23	A	G	2: 69,823,807	E7G	possibly damaging	Het
Mthfd2	A	G	6: 83,310,535		probably benign	Het
Olfr1161	T	A	2: 88,025,120	Y133N	probably damaging	Het
Parn	A	G	16: 13,664,685	S100P	probably benign	Het
Podnl1	A	T	8: 84,131,985	I505F	possibly damaging	Het
Ppp6r3	G	T	19: 3,511,978	Q228K	probably damaging	Het
Rab22a	C	T	2: 173,695,263	T85M	probably damaging	Het
Siah1b	G	A	X: 164,071,692	P131S	probably damaging	Het
Skor2	C	T	18: 76,859,461	P293S	unknown	Het
Sox18	T	C	2: 181,670,876	K154R	probably damaging	Het
Tfpi	A	T	2: 84,458,082	L10Q	probably null	Het
Trim66	A	T	7: 109,481,995	I239N	probably damaging	Het
Ttll1	T	A	15: 83,492,609	K304N	probably damaging	Het
Vmn1r5	G	A	6: 56,985,648	V103I	probably benign	Het
Vnn1	T	C	10: 23,894,891	W6R	probably benign	Het
Wdr35	A	G	12: 9,015,995	Y651C	probably benign	Het

Other mutations in Corin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Corin	APN	5	72304888	missense	probably damaging	1.00
IGL01114:Corin	APN	5	72305011	missense	probably damaging	1.00
IGL01351:Corin	APN	5	72338991	missense	probably damaging	1.00
IGL01516:Corin	APN	5	72454487	nonsense	probably null
IGL01785:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01786:Corin	APN	5	72339876	missense	probably damaging	1.00
IGL01845:Corin	APN	5	72353939	missense	probably damaging	1.00
IGL02097:Corin	APN	5	72372146	missense	probably damaging	1.00
IGL02629:Corin	APN	5	72332673	missense	probably damaging	1.00
IGL03085:Corin	APN	5	72353930	missense	probably damaging	1.00
IGL03120:Corin	APN	5	72360689	missense	probably damaging	1.00
IGL03150:Corin	APN	5	72302858	missense	probably damaging	1.00
IGL03183:Corin	APN	5	72301586	missense	probably damaging	0.99
IGL03185:Corin	APN	5	72332781	missense	probably damaging	1.00
IGL03408:Corin	APN	5	72342961	missense	probably benign	0.40
alpaca	UTSW	5	72503952	missense	possibly damaging	0.85
R0078:Corin	UTSW	5	72454473	missense	possibly damaging	0.77
R0724:Corin	UTSW	5	72332795	splice site	probably benign
R1065:Corin	UTSW	5	72301650	nonsense	probably null
R1301:Corin	UTSW	5	72304933	missense	possibly damaging	0.81
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1466:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1520:Corin	UTSW	5	72330895	missense	probably damaging	1.00
R1584:Corin	UTSW	5	72302790	critical splice donor site	probably null
R1617:Corin	UTSW	5	72503952	missense	possibly damaging	0.85
R1912:Corin	UTSW	5	72358403	missense	probably damaging	1.00
R2059:Corin	UTSW	5	72316051	missense	possibly damaging	0.76
R2173:Corin	UTSW	5	72504079	missense	probably benign	0.01
R2242:Corin	UTSW	5	72332711	missense	probably damaging	1.00
R2373:Corin	UTSW	5	72339038	missense	probably damaging	1.00
R2850:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R3683:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3684:Corin	UTSW	5	72330855	missense	probably damaging	1.00
R3790:Corin	UTSW	5	72435298	missense	probably benign	0.38
R3847:Corin	UTSW	5	72422165	missense	probably benign	0.13
R3926:Corin	UTSW	5	72372130	missense	probably damaging	1.00
R3939:Corin	UTSW	5	72339879	missense	possibly damaging	0.80
R3945:Corin	UTSW	5	72358424	missense	probably damaging	1.00
R4079:Corin	UTSW	5	72503883	missense	probably benign	0.03
R4224:Corin	UTSW	5	72343108	missense	probably damaging	1.00
R4585:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4586:Corin	UTSW	5	72329699	missense	probably damaging	1.00
R4849:Corin	UTSW	5	72302835	missense	probably damaging	1.00
R4926:Corin	UTSW	5	72372182	missense	probably damaging	1.00
R5080:Corin	UTSW	5	72353851	intron	probably benign
R5138:Corin	UTSW	5	72339059	missense	probably damaging	1.00
R5262:Corin	UTSW	5	72304955	missense	probably damaging	1.00
R5268:Corin	UTSW	5	72343019	missense	probably damaging	1.00
R5302:Corin	UTSW	5	72316098	missense	probably benign	0.07
R5307:Corin	UTSW	5	72356978	missense	probably damaging	1.00
R5324:Corin	UTSW	5	72435257	missense	probably damaging	1.00
R5352:Corin	UTSW	5	72305033	missense	probably benign	0.04
R5373:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5374:Corin	UTSW	5	72304953	missense	probably damaging	1.00
R5484:Corin	UTSW	5	72358484	missense	probably benign	0.15
R5502:Corin	UTSW	5	72316106	nonsense	probably null
R5544:Corin	UTSW	5	72305014	nonsense	probably null
R5682:Corin	UTSW	5	72422154	missense	possibly damaging	0.85
R5818:Corin	UTSW	5	72435395	missense	probably benign	0.00
R5992:Corin	UTSW	5	72316389	missense	probably benign	0.01
R6115:Corin	UTSW	5	72360729	missense	probably damaging	1.00
R6181:Corin	UTSW	5	72372096	critical splice donor site	probably null
R6317:Corin	UTSW	5	72339045	missense	probably damaging	1.00
R7053:Corin	UTSW	5	72301527	missense	probably benign	0.28
R7242:Corin	UTSW	5	72305055	missense	probably benign	0.14
R7452:Corin	UTSW	5	72435247	missense	possibly damaging	0.94
R7783:Corin	UTSW	5	72301624	missense	probably benign	0.26
R7903:Corin	UTSW	5	72301500	missense	probably benign	0.00
R7956:Corin	UTSW	5	72422187	missense	probably damaging	0.99
R8007:Corin	UTSW	5	72316103	missense	probably damaging	0.96
R8125:Corin	UTSW	5	72358463	missense	probably damaging	0.96
R8215:Corin	UTSW	5	72305018	missense	probably damaging	1.00
R8251:Corin	UTSW	5	72356926	missense	probably damaging	1.00
R8364:Corin	UTSW	5	72304931	missense	probably benign
R8505:Corin	UTSW	5	72435407	missense	probably benign	0.21
R8746:Corin	UTSW	5	72435352	missense	probably benign	0.31
R8887:Corin	UTSW	5	72329610	critical splice donor site	probably null
Z1177:Corin	UTSW	5	72454493	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATGCCGCTTCCTAGAATAAGC -3'
(R):5'- GGTGCTAGGTACTGATCTGAAG -3'

Sequencing Primer
(F):5'- GCAAACAGTTTACTTATTCCAACAC -3'
(R):5'- GGTACTGATCTGAAGTGATAGTACC -3'

Posted On

2015-07-21