Incidental Mutation 'R4473:Alb'
ID330453
Institutional Source Beutler Lab
Gene Symbol Alb
Ensembl Gene ENSMUSG00000029368
Gene Namealbumin
SynonymsAlb1, Alb-1
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90460897-90476602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90464053 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 114 (C114R)
Ref Sequence ENSEMBL: ENSMUSP00000031314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031314]
Predicted Effect probably damaging
Transcript: ENSMUST00000031314
AA Change: C114R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031314
Gene: ENSMUSG00000029368
AA Change: C114R

DomainStartEndE-ValueType
ALBUMIN 20 205 1.54e-84 SMART
ALBUMIN 212 397 3.43e-82 SMART
ALBUMIN 404 595 1.51e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201737
Meta Mutation Damage Score 0.9634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes albumin, an abundant plasma protein essential for maintaining oncotic pressure that functions as a carrier protein for various molecules such as steriods and fatty acids in blood. This gene is primarily expressed in liver where the encoded protein undergoes proteolytic processing before secretion into the plasma. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a TALEN-mediated deletion exhibit analbuminemia but appear healthy and grossly normal and breed normally. Mice heterozygotes for an ENU-induced point mutation have significantly reduced plasma albumin and calcium levels and significantly elevated alkaline phosphatase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Alb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Alb APN 5 90472073 missense probably benign 0.00
IGL01508:Alb APN 5 90470838 missense probably benign 0.19
IGL01722:Alb APN 5 90470839 critical splice donor site probably null
IGL02103:Alb APN 5 90464131 missense probably benign 0.00
IGL02379:Alb APN 5 90465879 missense probably benign 0.00
IGL02531:Alb APN 5 90467448 missense probably damaging 1.00
IGL02704:Alb APN 5 90468509 missense possibly damaging 0.82
IGL02828:Alb APN 5 90467388 missense probably benign 0.17
IGL03248:Alb APN 5 90461714 splice site probably benign
R0714:Alb UTSW 5 90462806 missense possibly damaging 0.81
R1418:Alb UTSW 5 90464202 splice site probably benign
R1708:Alb UTSW 5 90464051 missense possibly damaging 0.73
R2092:Alb UTSW 5 90463983 frame shift probably null
R4670:Alb UTSW 5 90462806 missense probably benign 0.00
R4758:Alb UTSW 5 90468593 missense probably benign 0.00
R5583:Alb UTSW 5 90468593 missense probably benign 0.00
R6384:Alb UTSW 5 90472640 missense possibly damaging 0.67
R7268:Alb UTSW 5 90462716 missense probably benign 0.15
R7295:Alb UTSW 5 90462834 critical splice donor site probably null
R7320:Alb UTSW 5 90464987 critical splice donor site probably null
R7337:Alb UTSW 5 90474593 missense probably damaging 1.00
R7505:Alb UTSW 5 90469509 missense probably damaging 1.00
R7575:Alb UTSW 5 90465929 missense probably damaging 1.00
R7651:Alb UTSW 5 90467355 missense probably damaging 1.00
R7652:Alb UTSW 5 90467355 missense probably damaging 1.00
R7654:Alb UTSW 5 90467355 missense probably damaging 1.00
R7669:Alb UTSW 5 90463991 missense possibly damaging 0.93
R7870:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7879:Alb UTSW 5 90472648 missense probably benign 0.21
R7953:Alb UTSW 5 90472629 missense possibly damaging 0.96
R7962:Alb UTSW 5 90472648 missense probably benign 0.21
Z1177:Alb UTSW 5 90468512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTCGTTTGCCTCGCAG -3'
(R):5'- GCATAAAGTGTAGATGTCTGGGTAC -3'

Sequencing Primer
(F):5'- CGTTTGCCTCGCAGTTTAAAAACG -3'
(R):5'- GGTACTCACTGTCCCATAAAGGTG -3'
Posted On2015-07-21