Incidental Mutation 'R4473:Atp2a2'
ID330454
Institutional Source Beutler Lab
Gene Symbol Atp2a2
Ensembl Gene ENSMUSG00000029467
Gene NameATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms9530097L16Rik, SERCA2, D5Wsu150e, SERCA2B, sarco/endoplasmic reticulum Ca2+-ATPase 2
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122453513-122502225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122457264 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1008 (S1008T)
Ref Sequence ENSEMBL: ENSMUSP00000135935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031423] [ENSMUST00000177974] [ENSMUST00000179939]
Predicted Effect probably benign
Transcript: ENSMUST00000031423
AA Change: S1008T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031423
Gene: ENSMUSG00000029467
AA Change: S1008T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 2.1e-66 PFAM
Pfam:Hydrolase 345 714 1.2e-18 PFAM
Pfam:HAD 348 711 1e-18 PFAM
Pfam:Cation_ATPase 418 527 2.5e-24 PFAM
Pfam:Hydrolase_3 682 746 1.9e-7 PFAM
Pfam:Cation_ATPase_C 783 986 2.4e-48 PFAM
transmembrane domain 1015 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177974
SMART Domains Protein: ENSMUSP00000136104
Gene: ENSMUSG00000029467

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 5.1e-66 PFAM
Pfam:Hydrolase 345 714 2.7e-18 PFAM
Pfam:HAD 348 711 2.6e-18 PFAM
Pfam:Cation_ATPase 418 527 4.7e-24 PFAM
Pfam:Hydrolase_3 682 746 7.2e-7 PFAM
Pfam:Cation_ATPase_C 783 986 5.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179939
AA Change: S1008T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135935
Gene: ENSMUSG00000029467
AA Change: S1008T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 93 341 9e-69 PFAM
Pfam:HAD 348 711 1.2e-16 PFAM
Pfam:Hydrolase_like2 418 527 3.1e-24 PFAM
Pfam:Hydrolase 496 714 8.7e-24 PFAM
Pfam:Hydrolase_3 682 746 3.4e-7 PFAM
Pfam:Cation_ATPase_C 783 986 1.6e-47 PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted homozygous mutants are embryonic lethal while heterozygotes show reduced blood pressure and mildly impaired cardiac contractility and relaxation. Aged heterozygotes for one targeted mutation develop squamous cell tumors of the forestomach, esophagus, oral mucosa, tongue, and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Atp2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Atp2a2 APN 5 122458083 splice site probably null
IGL01459:Atp2a2 APN 5 122469652 missense probably benign 0.03
IGL01721:Atp2a2 APN 5 122500792 missense possibly damaging 0.89
IGL02614:Atp2a2 APN 5 122489303 missense probably benign 0.00
IGL02616:Atp2a2 APN 5 122461684 missense probably benign 0.07
IGL02826:Atp2a2 APN 5 122489291 missense probably benign 0.03
IGL02876:Atp2a2 APN 5 122466008 missense probably benign 0.18
PIT4458001:Atp2a2 UTSW 5 122457309 nonsense probably null
R0087:Atp2a2 UTSW 5 122460961 missense probably benign 0.02
R0139:Atp2a2 UTSW 5 122491715 missense probably damaging 1.00
R0166:Atp2a2 UTSW 5 122466838 missense possibly damaging 0.69
R0457:Atp2a2 UTSW 5 122469714 missense probably benign
R0658:Atp2a2 UTSW 5 122457633 splice site probably benign
R0815:Atp2a2 UTSW 5 122471236 missense probably benign 0.02
R1282:Atp2a2 UTSW 5 122491754 missense probably benign 0.00
R1538:Atp2a2 UTSW 5 122457377 missense probably damaging 1.00
R1985:Atp2a2 UTSW 5 122466836 missense probably benign 0.03
R2111:Atp2a2 UTSW 5 122459546 missense probably damaging 1.00
R2517:Atp2a2 UTSW 5 122457513 missense probably damaging 0.99
R4225:Atp2a2 UTSW 5 122469726 missense probably benign
R4956:Atp2a2 UTSW 5 122461580 missense probably benign 0.02
R4969:Atp2a2 UTSW 5 122458491 missense possibly damaging 0.95
R5242:Atp2a2 UTSW 5 122461946 missense probably damaging 1.00
R5307:Atp2a2 UTSW 5 122461747 missense probably benign 0.06
R5497:Atp2a2 UTSW 5 122458169 missense probably damaging 1.00
R5536:Atp2a2 UTSW 5 122457182 missense probably benign 0.05
R5629:Atp2a2 UTSW 5 122460096 missense probably damaging 1.00
R5641:Atp2a2 UTSW 5 122457576 missense probably damaging 1.00
R6365:Atp2a2 UTSW 5 122461916 missense probably benign 0.20
R6383:Atp2a2 UTSW 5 122501649 missense probably benign 0.37
R6534:Atp2a2 UTSW 5 122457198 missense possibly damaging 0.73
R7162:Atp2a2 UTSW 5 122489324 missense probably benign 0.00
R7259:Atp2a2 UTSW 5 122466069 missense probably benign 0.27
R7268:Atp2a2 UTSW 5 122467729 missense probably benign 0.00
R7465:Atp2a2 UTSW 5 122461700 missense probably benign
R7489:Atp2a2 UTSW 5 122467767 missense probably benign
R7567:Atp2a2 UTSW 5 122491784 missense probably benign 0.29
R7729:Atp2a2 UTSW 5 122491766 missense probably benign 0.30
R7734:Atp2a2 UTSW 5 122458527 missense possibly damaging 0.95
R7739:Atp2a2 UTSW 5 122469705 missense probably damaging 0.98
R7743:Atp2a2 UTSW 5 122461571 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCACCAGCCAATATGTTCATGTG -3'
(R):5'- AGCTTGACCCAGCCTTGTTTG -3'

Sequencing Primer
(F):5'- ATTCAGCAGAAATAGACAGTTGC -3'
(R):5'- GACCCAGCCTTGTTTGTCTCAG -3'
Posted On2015-07-21