Incidental Mutation 'R4473:Vmn1r5'
ID330456
Institutional Source Beutler Lab
Gene Symbol Vmn1r5
Ensembl Gene ENSMUSG00000090346
Gene Namevomeronasal 1 receptor 5
SynonymsV1rc19
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location56970273-56988390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56985648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 103 (V103I)
Ref Sequence ENSEMBL: ENSMUSP00000154081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164307] [ENSMUST00000226130] [ENSMUST00000228276]
Predicted Effect probably benign
Transcript: ENSMUST00000164307
AA Change: V103I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131092
Gene: ENSMUSG00000090346
AA Change: V103I

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226130
AA Change: V103I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228276
AA Change: V103I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Vmn1r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Vmn1r5 APN 6 56985926 missense probably damaging 0.98
IGL02027:Vmn1r5 APN 6 56985655 missense probably damaging 0.97
IGL03133:Vmn1r5 APN 6 56985615 missense probably benign 0.10
IGL03412:Vmn1r5 APN 6 56985933 missense possibly damaging 0.90
R0316:Vmn1r5 UTSW 6 56985799 missense probably benign 0.27
R0378:Vmn1r5 UTSW 6 56985585 missense probably benign 0.00
R0946:Vmn1r5 UTSW 6 56986165 missense possibly damaging 0.64
R1511:Vmn1r5 UTSW 6 56985786 missense probably benign 0.02
R1553:Vmn1r5 UTSW 6 56985498 missense probably benign 0.00
R1823:Vmn1r5 UTSW 6 56985595 missense probably damaging 0.98
R3980:Vmn1r5 UTSW 6 56985651 missense probably damaging 1.00
R4742:Vmn1r5 UTSW 6 56986251 nonsense probably null
R5321:Vmn1r5 UTSW 6 56985607 missense probably damaging 1.00
R5364:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
R6102:Vmn1r5 UTSW 6 56986114 missense probably damaging 0.96
R6581:Vmn1r5 UTSW 6 56985381 missense probably benign
R6885:Vmn1r5 UTSW 6 56986057 missense possibly damaging 0.89
R7297:Vmn1r5 UTSW 6 56986219 missense possibly damaging 0.94
R8063:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
Z1176:Vmn1r5 UTSW 6 56985948 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAGGTCACAGACGTAAGCCC -3'
(R):5'- GAGCAGTATTTAGTAGCCTTCATCTG -3'

Sequencing Primer
(F):5'- AGACCTGATCTCCTGTCAACTGAC -3'
(R):5'- GTTTGGTCTCACTCACATTGG -3'
Posted On2015-07-21