Incidental Mutation 'R4473:Mthfd2'
ID330457
Institutional Source Beutler Lab
Gene Symbol Mthfd2
Ensembl Gene ENSMUSG00000005667
Gene Namemethylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase
SynonymsNMDMC
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4473 (G1)
Quality Score158
Status Validated
Chromosome6
Chromosomal Location83305691-83325908 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83310535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005810] [ENSMUST00000203847] [ENSMUST00000204472]
Predicted Effect probably benign
Transcript: ENSMUST00000005810
SMART Domains Protein: ENSMUSP00000005810
Gene: ENSMUSG00000005667

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 155 8.1e-45 PFAM
Pfam:THF_DHG_CYH_C 158 332 7.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203437
Predicted Effect probably benign
Transcript: ENSMUST00000203847
SMART Domains Protein: ENSMUSP00000145266
Gene: ENSMUSG00000005667

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 108 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204472
SMART Domains Protein: ENSMUSP00000145222
Gene: ENSMUSG00000005667

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 20 97 2.2e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Mthfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Mthfd2 APN 6 83310511 missense probably benign 0.12
IGL01844:Mthfd2 APN 6 83311810 critical splice donor site probably null
IGL02936:Mthfd2 APN 6 83311360 missense probably damaging 1.00
R0130:Mthfd2 UTSW 6 83309008 missense probably damaging 0.99
R0862:Mthfd2 UTSW 6 83313394 missense probably damaging 0.99
R1902:Mthfd2 UTSW 6 83306731 missense probably damaging 1.00
R3431:Mthfd2 UTSW 6 83311348 missense probably benign 0.30
R3732:Mthfd2 UTSW 6 83313475 missense probably damaging 1.00
R5301:Mthfd2 UTSW 6 83310483 missense probably damaging 1.00
R5730:Mthfd2 UTSW 6 83317459 missense probably benign 0.35
R7126:Mthfd2 UTSW 6 83313490 missense probably benign 0.02
R7594:Mthfd2 UTSW 6 83306683 missense probably benign 0.00
R7602:Mthfd2 UTSW 6 83311848 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCACAGGATGGCTTTTGAGAG -3'
(R):5'- TTGGATTTGTGACCCAGGTC -3'

Sequencing Primer
(F):5'- ACAGGATGGCTTTTGAGAGTTATCAC -3'
(R):5'- TCTGATACACATTCTAAGACAGAGC -3'
Posted On2015-07-21