Incidental Mutation 'R4473:Fancf'
ID330459
Institutional Source Beutler Lab
Gene Symbol Fancf
Ensembl Gene ENSMUSG00000092118
Gene NameFanconi anemia, complementation group F
Synonyms
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4473 (G1)
Quality Score198
Status Validated
Chromosome7
Chromosomal Location51860577-51862267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51862200 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 19 (C19R)
Ref Sequence ENSEMBL: ENSMUSP00000125812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129604] [ENSMUST00000169357]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107589
SMART Domains Protein: ENSMUSP00000103215
Gene: ENSMUSG00000030498

DomainStartEndE-ValueType
CH 37 153 5.69e-15 SMART
low complexity region 167 178 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:GAS2 201 250 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132335
Predicted Effect probably benign
Transcript: ENSMUST00000169357
AA Change: C19R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125812
Gene: ENSMUSG00000092118
AA Change: C19R

DomainStartEndE-ValueType
Pfam:FANCF 1 336 3.4e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208016
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Fancf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Fancf APN 7 51861287 missense probably benign 0.40
R0478:Fancf UTSW 7 51861692 missense probably damaging 1.00
R4969:Fancf UTSW 7 51861448 nonsense probably null
R7302:Fancf UTSW 7 51861704 missense probably damaging 0.96
R7510:Fancf UTSW 7 51862205 missense probably damaging 1.00
X0063:Fancf UTSW 7 51861455 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGTCCAGGAGTTTGCG -3'
(R):5'- GAAACCATGGTGCGAGACTG -3'

Sequencing Primer
(F):5'- GGAACAGCAAGCTCGGC -3'
(R):5'- CATGGTGCGAGACTGACACG -3'
Posted On2015-07-21