Incidental Mutation 'R4473:Podnl1'
ID330460
Institutional Source Beutler Lab
Gene Symbol Podnl1
Ensembl Gene ENSMUSG00000012889
Gene Namepodocan-like 1
Synonyms
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4473 (G1)
Quality Score219
Status Validated
Chromosome8
Chromosomal Location84125989-84132527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84131985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 505 (I505F)
Ref Sequence ENSEMBL: ENSMUSP00000091073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000093380] [ENSMUST00000117424]
Predicted Effect probably benign
Transcript: ENSMUST00000040383
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093380
AA Change: I505F

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889
AA Change: I505F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117424
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154029
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Podnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Podnl1 APN 8 84132195 missense probably benign 0.31
IGL03151:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03197:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03198:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03225:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03290:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03368:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03493:Podnl1 APN 8 84132189 missense probably benign 0.44
PIT4472001:Podnl1 UTSW 8 84127848 missense
R1056:Podnl1 UTSW 8 84129276 missense probably benign 0.00
R1962:Podnl1 UTSW 8 84127297 missense probably benign 0.04
R4367:Podnl1 UTSW 8 84127268 missense probably benign 0.03
R4412:Podnl1 UTSW 8 84130665 missense probably benign 0.00
R4715:Podnl1 UTSW 8 84126061 start gained probably benign
R5009:Podnl1 UTSW 8 84126258 missense probably benign 0.01
R5013:Podnl1 UTSW 8 84126336 missense probably damaging 0.99
R5153:Podnl1 UTSW 8 84130643 missense probably benign 0.00
R7596:Podnl1 UTSW 8 84126395 missense
Predicted Primers PCR Primer
(F):5'- ACCACCATTATTGAGCAAGGATC -3'
(R):5'- CGGCTCTGATGCTGGTCATATG -3'

Sequencing Primer
(F):5'- CACCATTATTGAGCAAGGATCTGGAG -3'
(R):5'- GGTCATATGAAGCCTGTTAGCCC -3'
Posted On2015-07-21